1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Helen [10]
3 years ago
10

Physical differences between the jaws of the gorilla, Australopithecus, and modern human?

Biology
1 answer:
katrin [286]3 years ago
7 0
The angle of jaw and type of teeth in each jaw are the main big differences.
You might be interested in
During transcription, which end of the new rna molecule protrudes from the rna polymerase?
Katena32 [7]
<span>The 5' end During transcription, new nucleotides are added to the 3' end of the molecule due to the arrangement of the nucleotide with the new nucleotide being added to the hydroxyl group at the 3' position of the ribose.</span>
3 0
3 years ago
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
How do you transcribe dna to mrna to rna
zimovet [89]
Act
Cat
Gag
Tact


Those are the only ones I can find :/
3 0
3 years ago
A tall green plant is homozygous for each trait. If T is the tall allele,and G is the green allele, what are the genotype and th
olganol [36]

Answer:

GGTT,100% green and tall

Explanation:

3 0
3 years ago
Read 2 more answers
What does the nucleus of the cell contain?
Alex777 [14]

Answer:

DNA

Explanation:

6 0
3 years ago
Other questions:
  • Joe was observing an embryo with 16 cells.what is a 16-celled enbryo called?
    6·1 answer
  • Describe generally what happened to each spot of each type of ink. which had the most pigments?
    13·1 answer
  • 1. How many grams are equivalent to 0.54 kilograms​
    8·1 answer
  • Environmental factors can cause various changes in ecosystems. Which of the following would most likely have the greatest lastin
    11·2 answers
  • Gulls don’t eat herring but they are apart of the food web. How is the gulls population affected if herring disappeared
    11·1 answer
  • Ferns grow by:<br><br><br> photosynthesis<br><br> reproduction<br><br> mitosis
    10·1 answer
  • How could a substance that stops the synthesis of mRNA cause the liver to stop functioning (the death of liver cells)?
    5·2 answers
  • If R is dominant over r what is the chance that an offspring will exhibit the dominant trait
    10·1 answer
  • A doctoral student in biology, Esther Mensah, is reviewing primary literature over RNAi interference as part of her literary res
    12·1 answer
  • Arrange the events of meiosis l of an animal cell in the correct order
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!