They aren't all the same is not true of evolutionary trees.
<h3>What are evolutionary trees?</h3>
Evolutionary trees are trees that help to arrange and reconstruct the evolutionary history of species or groups of organisms belonging to either genera, families, or orders. The trees reconstruct and show case two form of information that is related to evolutionary change, cladogenesis and anagenesis.
Therefore, They aren't all the same is not true of evolutionary trees.
Learn more about evolutionary tress here.
brainly.com/question/2189834
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
What I know is that amino acid has side chain, amine groupe ,and groupe of carboxyl so what make them difference is side group where the is 20 different R-group which give each individual characteristics
1. Answer: to answer questions about the natural world
The aim of scientific method is to answer a question that the scientist have. To answer the question, the scientist need to design a research or observation. If the research is flawed, the result might not match with the scientist aim and the conclusion will be wrong. Scientific method can be used to help design the research so it will have less flaw
2. Answer: fertilizer
The student wants to determine the effect of a certain brand of liquid fertilizer on the growth of ivy. The fertilizer are hoped to influence the growth of the ivy. Independent variable is the variable that hoped to influence the dependent variable. So, the independent variable would be fertilizer and the dependent variable would be the growth.
Answer:
All carbon is in the form of carbon dioxide