1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
liraira [26]
3 years ago
8

What are two ways carbon returns from animals into the water?

Biology
1 answer:
SVETLANKA909090 [29]3 years ago
6 0

Answer:

fecal matter and liquids

Explanation:

You might be interested in
Which of the following is NOT true of
stich3 [128]

They aren't all the same is not true of evolutionary trees.

<h3>What are evolutionary trees?</h3>

Evolutionary trees are trees that help to arrange and reconstruct the evolutionary history of species or groups of organisms belonging to either genera, families, or orders. The trees reconstruct and show case two form of information that is related to evolutionary change, cladogenesis and anagenesis.

Therefore, They aren't all the same is not true of evolutionary trees.

Learn more about evolutionary tress here.

brainly.com/question/2189834

6 0
2 years ago
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
Describe the structure of amino acids, including what makes amino acids different from each other.
ludmilkaskok [199]
What I know is that amino acid has side chain, amine groupe ,and  groupe of carboxyl so what make them difference is side group where the is 20 different R-group which give each individual characteristics 

7 0
3 years ago
1. Why do scientists use the scientific method?
Xelga [282]

1. Answer: to answer questions about the natural world


The aim of scientific method is to answer a question that the scientist have. To answer the question, the scientist need to design a research or observation. If the research is flawed, the result might not match with the scientist aim and the conclusion will be wrong. Scientific method can be used to help design the research so it will have less flaw


2. Answer: fertilizer

The student wants to determine the effect of a certain brand of liquid fertilizer on the growth of ivy. The fertilizer are hoped to influence the growth of the ivy. Independent variable is the variable that hoped to influence the dependent variable. So, the independent variable would be fertilizer and the dependent variable would be the growth.

6 0
3 years ago
Which statement is best represented by the diagram?
Vaselesa [24]

Answer:

All carbon is in the form of carbon dioxide

5 0
3 years ago
Other questions:
  • Which body system works with your digestive system to push your food along through your intestines?
    9·2 answers
  • I don’t understand stand help me
    7·1 answer
  • For a cell to maintain the appropriate balance of materials inside and outside of the cell, materials must be able to move in an
    5·1 answer
  • A different DNA ladder from NEB (Cat #N3200L) comes as 500 uL of a 1000 ug/mL solution and is not pre-mixed with the 6 X DNA loa
    7·1 answer
  • How were fossils of plants found in antarctica
    12·1 answer
  • 1. A brown mink crossed with a silver-blue mink produced all brown offspring. When these F1 were crossed among themselves, they
    9·1 answer
  • PLZ HELP FAST!!!!!
    12·2 answers
  • Which is one factor that contributes to the formation of polar, temperate, and tropical zones?
    6·2 answers
  • Pls help I asked 3 times and I used all my points!! Which field studies all organisms that have existed, where they came from, a
    9·2 answers
  • Characteristics such as eye color, that are passed from one generation to the next, are known as ______.
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!