1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ella [17]
3 years ago
5

Directions

Biology
1 answer:
Vika [28.1K]3 years ago
7 0

Answer:

hypothesis is an idea or explanation that then test through study and experimentation

You might be interested in
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Primates evolved during what era ​
DerKrebs [107]
The beginning of the Eocene Epoch Era.
6 0
3 years ago
Genetic modification of organisms in aquafarming
densk [106]
The answer would be B
6 0
3 years ago
identify one condition, other than identical young plants, that should be held constant during experiment
JulsSmile [24]

Answer:

It depends on the experiment I think

Explanation:

8 0
3 years ago
I’ll make brainliest:)))
kozerog [31]
The digital signal can then be recorded, edited, and modifies using digital audio tools. A transducer which converts sound pressure waves into electrical signals. a digital-to-analog converter will convert a digital signal back into an analog signal, which analog circuits amplify and send to a loudspeaker.
6 0
3 years ago
Read 2 more answers
Other questions:
  • What kind of organism is a heterotroph?
    12·2 answers
  • Why do you think digestion is more efficent if you are sitting up?
    11·1 answer
  • What term refers to organisms magnified with a microscope
    8·1 answer
  • What contents of the lysosome aids in their digestive function?
    6·1 answer
  • The force of Gravity pulls the water towards the ground ,then why does it move against this gravitational force in a plant?????
    12·1 answer
  • What is NOT an example of adheaion? Please help!!
    13·1 answer
  • What did Mendel call all the offspring from the cross?
    11·1 answer
  • All of the following might lead to a disease caused by an opportunistic pathogen except __________.
    6·1 answer
  • What do you call protozoa that you can see with the naked eye?
    11·1 answer
  • Which heart chamber pumps blood toward the alveoli<br> by way of the pulmonary arteries?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!