1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
rosijanka [135]
3 years ago
13

What is the MAIN cause of increased erosion, especially for soil?

Biology
2 answers:
atroni [7]3 years ago
4 0

B) flash floods this because d not main c not main and a not main

tresset_1 [31]3 years ago
3 0

Answer:

c

Explanation:

You might be interested in
To create animals that have the characters of both species some people have bred buffalo and cattle together? This is an example
nikdorinn [45]
It's an example of crossbreeding.
3 0
3 years ago
Which is the best definition of conservation biology?
murzikaleks [220]
Conservation biology<span> is the management of nature and of Earth's biodiversity with the aim of protecting species, their habitats, and ecosystems from excessive rates of extinction and the erosion of biotic interactions.</span>
7 0
3 years ago
Read 2 more answers
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
The population density decreases as the number of individuals in an area increases. true or false
elena55 [62]
This is false the population density will decrease as the area decreases
4 0
2 years ago
Genotypes are the genes of an organism with alleles represented by letters of the alphabet. Phenotypes are an organism's observa
Dennis_Churaev [7]

Answer:

True

Explanation:

This is correct for both Genotypes and Phenotypes.

8 0
3 years ago
Read 2 more answers
Other questions:
  • Why chlorophyll appears green to us in
    12·1 answer
  • Will anyone help me on my biology homework...? Please and thank you?
    13·1 answer
  • Which of the following provides the best description of a difference between prokaryotic and eukaryotic cells?
    12·2 answers
  • An energy pyramid shows the amount of available at each feeding level in an ecosystem.​
    5·1 answer
  • You are comparing two peptides translated in two different cells. The peptide has an identical primary structure, but there is m
    11·1 answer
  • You have been asked to help a top nutrition researcher conduct human experiments on vitamin
    13·1 answer
  • Where in the cell is atp produced
    6·1 answer
  • Which is the best analogy for classification?
    11·2 answers
  • If the earthquake's focus was 2 kilometers below Earth's surface, the earthquake occurred in the?
    8·1 answer
  • a dna strand is aacgtaacg . what will be the sequence of the mrna? uug ugc aacgtaacg atgcatgc aacgtaacg
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!