1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Art [367]
3 years ago
14

Scientific names show the classification groups...

Biology
1 answer:
Juli2301 [7.4K]3 years ago
7 0

scientific names show the classification groups..... what is the question

You might be interested in
Compare clonal selection to a phosphorylation cascade that occurs in a signal transduction pathway. How are they similar to one
dybincka [34]
<h2>Clonal Selection to a Phosphorylation Cascade </h2>

Clonal selection describes the roles of compartments of the privileged operation in reply to specific antigens attacking the basis in immunology. A phosphorylation cascade is a series of situations wherever one catalyst phosphorylates is different. It makes a succession reactions driving the phosphorylation of thousands of proteins. This can be observed in omen transduction of hormone communications.


4 0
3 years ago
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
Which of the following is not true of young drivers?
DENIUS [597]
A is the most sensible answer
3 0
3 years ago
Read 2 more answers
Would you describe viruses as "living organisms"? Why or why not?
adell [148]
No it is not because they cannot do anything without a living cell, like reproducing.
5 0
3 years ago
How many bones are in the human body?
liraira [26]

Answer:

206 bones

Explanation:

4 0
3 years ago
Read 2 more answers
Other questions:
  • Photosynthesis continues to increase with temperature
    11·1 answer
  • The simplest sugars are generally called what?
    14·2 answers
  • 11
    9·1 answer
  • Which part of a plant is the reproductive structure that forms offspring thats are genetically distinct from its parent?
    10·1 answer
  • 39)
    10·1 answer
  • One way to describe a species is as a population adapted to a certain niche. That population has a small gene pool. If the membe
    11·1 answer
  • Which condition can cause a population crash?
    11·1 answer
  • 1. A bacteria cell that divides to create two exact copies of itself is an
    9·2 answers
  • In pea plants,the allele for the tallness is dominant.what are the possible genotypes of a tall pea plant
    7·1 answer
  • What type of reaction is shown below?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!