1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
allochka39001 [22]
3 years ago
5

What does the body use to build maintain and repair cells?

Biology
1 answer:
denis-greek [22]3 years ago
7 0

Proteins is used to build and repair cells.

Protein can be found in every living cell and it is very important building block in the body. Protein supply amino acids which were being used to create and repair cells, enzymes, red blood cells, antibodies and tissues. In the body, protein functions by maintaining fluid balance and transportation substances. Protein can be gotten from meat, dairy products, soyabeans, nuts, beans and certain grains.    However, protein from meat and other animal products are known as complete protein.  

You might be interested in
HELLO ASAP ITS FOR A TEST
noname [10]

Answer:

the answer is U shaped valley

4 0
3 years ago
Read 2 more answers
Describe two ways that humans influence the cycling of matter in ecosystems.
Lunna [17]

Explanation:

Two important ways by which humans have affected the carbon cycle, especially in recent history, are: 1) the release of carbon dioxide into the atmosphere during the burning of fossil fuels, and 2) the clearing of trees and other plants (deforestation) that absorb carbon dioxide from the atmosphere

7 0
3 years ago
Explain how does the skeletal system help aid the body when its sick.
makkiz [27]
There are several ways by which a skeletal system <span>help aid the body when its sick. Firstly, it helps in producing red blood cells in the body. It also helps in maintaining the level of calcium in the body. It also produces the stem cells that increases the immunity of the body. I hope that the answer has come to your help.</span>
4 0
3 years ago
Why will a set of stars appear at a different angle to us at different times of the year?
Semmy [17]
The answer is of course A
5 0
3 years ago
I’ll make brainliest:)))
kozerog [31]
The digital signal can then be recorded, edited, and modifies using digital audio tools. A transducer which converts sound pressure waves into electrical signals. a digital-to-analog converter will convert a digital signal back into an analog signal, which analog circuits amplify and send to a loudspeaker.
6 0
3 years ago
Read 2 more answers
Other questions:
  • What are the lines called that show land elevations on a contour map?
    7·1 answer
  • When an airplane increases its thrust, which of the following could happen
    8·1 answer
  • Natural selection is most likely to have different effects on organisms with which pair of alleles
    5·1 answer
  • A controlled experiment allows the scientist to isolate and test___________.a.a conclusion.b.a mass of information.c.several var
    10·1 answer
  • Some lizards can undergo both sexual and asexual reproduction. Being able to reproduce asexually benefits the organism during ti
    13·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • 100 points and Brainliest!!! Plus, an opportunity for an extra 100 points if correct.
    6·1 answer
  • A scientist is examining a single-celled organism that is often found in the human body; some examples of this organism are help
    13·2 answers
  • Which method of microbial control does not rely on d naturing proteins or disrupting the cell membrane
    11·1 answer
  • Suppose the rate of plant growth on isle royale supports an equilibrium moose population of 850 moose in this scenario there are
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!