1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Igoryamba
3 years ago
6

What is TRUE about the inside of an animal cell? A. The inside of an animal cell contains structures that carry out specialized

functions for the cell, but no water or air. The inside of the cell is completely solid. B. The inside of an animal cell contains water and molecules dissolved in the water, but no structures that perform specialized functions for the cell. C. The inside of an animal cell contains air and structures that perform specialized functions for the cell, but no water. D. The inside of an animal cell contains water, molecules dissolved in the water, and structures that perform specialized functions for the cell.
Biology
1 answer:
valentinak56 [21]3 years ago
4 0
D, The cell take in water and food some of the food dissolve to create other things for the cells and they have structures that perform to help us survive.
You might be interested in
Asteroids may be called planetoids (minor planets) because the largest known asteroid is only about kilometers in diameter.
Alla [95]

Answer: 1,000

Explanation:

The largest asteroid known as Ceres is about 950 - 1000 kilometers in diameter.

7 0
2 years ago
Read 2 more answers
Micronutrients are needed for _____.
IrinaK [193]
I think the answer is A
Hope this helps have a good night!
4 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Which data table describes the Sun? Composition mostly frozen nitrogen Mass 258.9 × 1018 kg Composition mostly hydrogen and heli
tigry1 [53]

Answer:

Composition: mostly hydrogen and helium gas

Mass: 1.989 × 10³⁰ kg

Explanation:

Sun is a star at the center of the solar system. It is mostly composed of Hydrogen and Helium gases. Fusion of Hydrogen into Helium in the core powers the sun. Huge amount of heat and light energy is liberated. The mass of the Sun is 1.989 × 10³⁰ kg. Sun is a Population I star.

8 0
3 years ago
Read 2 more answers
The large diversity of shapes of biological molecules is possible because of the extensive presence of _____ in the molecules. t
Yanka [14]

Answer;

Carbon

Explanation;

-The large diversity of shapes of biological molecules is possible because of the extensive presence of carbon  in the molecules.

-The major classes of biological molecules that are important for all living things are carbohydrates, lipids, proteins, and nucleic acids. These molecules differ in structure and function, in part, because of different functional groups.

All organic molecules contain carbon atoms. Biological macromolecules are organic, meaning that they contain carbon. In addition, they may contain hydrogen, oxygen, nitrogen, phosphorus, sulfur, and additional minor elements.

-Carbon qualifies as the foundation element for molecules in living things. It is the bonding properties of carbon atoms that are responsible for its important role.

4 0
3 years ago
Read 2 more answers
Other questions:
  • Identify the types of point mutations depicted
    5·1 answer
  • What would occur if a fetus's chorion tissue ruptured? The maternal tissue of the placenta would be damaged, causing bleeding. T
    14·2 answers
  • PLEASE HELP ASAP I DONT KNOW THIS. My teacher neverrrrr went over this
    15·1 answer
  • The observable, measurable outward characteristics of an organism are called the
    5·1 answer
  • During translation a what is created between two amino acids
    12·1 answer
  • Which of these organelles is responsible for protein synthesis?
    8·1 answer
  • which following food chain grass grasshopper field mouse red tailed hawk which organism in the food chain is the producer
    12·1 answer
  • The chemical energy stored in ATP during photosynthesis is released during the dark phase to
    13·2 answers
  • true or false: The endocrine system is made up of organs called neurons that release chemical signals directly into the bloodstr
    11·1 answer
  • 1. Populations do not permanently remain at carrying capacity T/F
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!