1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
almond37 [142]
3 years ago
5

How do you explain that the variability in a domesticated species is greater than in the same species, or a similar one, in the

wild? For example: dogs vs. wolves; chickens vs. red jungle fowl.
Biology
1 answer:
Gekata [30.6K]3 years ago
4 0

Explanation:

i believe it is because the domesticated breeds were bred specifically through generations in order to serve a specific purpose, for example dogs could be bred for hunting or herding, etc and chickens could be bred for eggs or meat, etc. but in the wild, their only job is to survive and reproduce.

You might be interested in
DNA is often compared to a twisted ladder. In this analogy, what forms the
Oxana [17]
A- on the sides you would find the phosphate and sugar so the center is the AT or CG
5 0
2 years ago
A rooster laid an egg on top of the barn roof. Which way did it roll?
docker41 [41]
Roosters don't lay eyes! :P
5 0
3 years ago
Read 2 more answers
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
2 years ago
In the prophase of mitosis, which of the following occurs? A. The chromosomes uncoil to form chromatin. B. The chromosomes coil
nexus9112 [7]
D. The chromatin coils and condenses into visible chromosomes.

is the correct answer....

HOPE IT HELPS YOU '_'
6 0
3 years ago
Read 2 more answers
Describe and explain enzyme​
gizmo_the_mogwai [7]
Nzymes are highly selective catalysts, meaning that each enzyme only speeds up a specific reaction. The molecules that an enzyme works with are called substrates. The substrates bind to a region on the enzyme called the active site. There are two theories explaining the enzyme-substrate interaction.
6 0
3 years ago
Other questions:
  • Which type of system or instrument would be best at gathering data on wind
    9·1 answer
  • Which statement is true about the cell theory?
    10·2 answers
  • Cycadophyta seeds are protected by __________________ .
    13·2 answers
  • What is the importance of DNA replication to all living organisms?
    5·1 answer
  • What cause water to be a polar molecule
    13·1 answer
  • A cell with 80 chromosomes undergoes meiosis. How many chromosomes are found in the daughter cells? How many daughter cells are
    6·1 answer
  • Which option shows the correct spelling of the word?
    8·2 answers
  • When energy is transferred to or from a substance, it can change the molecules’ freedom of movement. True or False?
    10·1 answer
  • . What is the first step of thermonuclear fusion within the Sun to form helium-4?
    13·2 answers
  • In 3–5 sentences, construct a summary of the process of gene expression, starting with DNA and ending with proteins.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!