1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
padilas [110]
3 years ago
14

All arteries carry oxygen-rich blood, whereas veins carry oxygen-poor blood. all arteries carry oxygen-rich blood, whereas veins

carry oxygen-poor blood.
a. True
b. False
Biology
2 answers:
Olin [163]3 years ago
6 0
All veins carry oxygen poor blood ...it is false
ycow [4]3 years ago
5 0
A.true
It's because all arteries carry oxygenated blood from heart to the tissue,except for arteries pulmonary which carry deoxygenated
Blood.
All veins carry deoxygenated blood from the tissues to the heart except for pulmonary veins which carry oxygenated blood to the heart.
You might be interested in
If a substance can be separated by physical means and it is not the same throughout, what is it? a heterogeneous mixture a homog
GenaCL600 [577]
<h2>answer:</h2>

a heterogeneous mixture

<h2>explanation:</h2>

A heterogeneous mixture is commonly any mixture that is not uniform in combination - it's a non-uniform mixture of smaller fundamental particles. Using different means, the particles in the mixture can be separated from one another. In a heterogeneous mixture, the elements do not mix completely, and the individual items that form the mixture can be identified. Heterogeneous mixtures can typically be separated back into their original components by chemical or physical means.

5 0
3 years ago
Nitrogen oxides from gas-burning cars and trucks that do not change form in the atmosphere are considered to be
liberstina [14]

Answer:

the answer is B

Explanation:

5 0
2 years ago
20. Ten horses sleep in the same
BabaBlast [244]

The horse has  a non-communicable disease.

Explanation:

  • In the given situation, only one horse is effected this suggest that the cause of the disease is not present in any other horse.
  • Though the horses were sleeping in same barn and sharing the same resources they did not get the disease. This clearly states that the disease does not spread from one individual to other but remains confined to only effected individual.
  • Thus it is a non infectious or non-communicable disease.
3 0
3 years ago
The major component of a cell membrane area. Proteins
salantis [7]

Answer:

A) phospholipids

Explanation:

5 0
3 years ago
Which of the following statements is true?
SVETLANKA909090 [29]
Your answer is "Hydropower uses the kinetic energy of water to generate electricity" 
3 0
3 years ago
Read 2 more answers
Other questions:
  • Write the letter all of the following statements that are NOT true. a. Coding sequences for gene products can be isolated from c
    9·1 answer
  • Any electricity charged object creates an electric field. Walking across carpet in wool socks can create an electric charge. Thi
    8·1 answer
  • What allows enzymes to interact with the substrate?​
    12·1 answer
  • Most cells are constantly replacing damaged molecules and organelles. Explain why a red blood cell is unable to replace damaged
    6·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • A newly transplanted organ is rejected by the immune system of the host. Which protein is responsible for the rejection
    5·1 answer
  • Please Help!! I need it :)
    5·1 answer
  • When does afterglow occur?​
    15·2 answers
  • Many foods—for example, bacon and salt cod—are preserved with high concentrations of salt. How can high concentrations of salt i
    15·1 answer
  • What Cell is squarish Shape at<br> Options Plant Cell<br> Animal Cell
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!