ATP is adenosine triphosphate, it is like a fully charged battery in a cell, ADP is basically ATP that has been drained of its energy from a chemical reaction. It is like a dead battery that can be recharged later ;)
They use them as food and habitats.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Once the rock has been weakened and broken up by weathering it is ready for erosion. Erosion happens when rocks and sediments are picked up and moved to another place by ice, water, wind or gravity. Mechanical weathering physically breaks up rock. One example is called frost action or frost shattering.
Most of the carbon in the earth is stored in the soil and air.
A) soil and air
<u>Explanation:</u>
Most of the carbon on earth is stored in rocks in the soil. There is approximately 2500 billion tons of carbon in the soil. The amount of carbon in the air is 800 billion tons and the amount of carbon found in plants and animals is 560 billion tons.
This clearly tells that most of the carbon in earth is stored in soil and air. The movement of carbon within the biosphere makes up the carbon cycle.
