1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sergij07 [2.7K]
3 years ago
14

Refer to the chart of amino acid structures to help answer this question. Which four statements about amino acids are true? Ser

and Gln are polar amino acids. The Leu side chain does not form hydrogen bonds with other amino acids. The form of glycine used by the human body is D‑glycine. Methionine is a thiol. Phe can undergo oxidation to form Tyr. Proline has an overall charge at physiological pH (7.4). Lysine has one stereocenter (chiral center).
Biology
1 answer:
Bad White [126]3 years ago
4 0

Answer:

1. Ser and Gln are polar amino acids.

2. The Leu side chain does not form hydrogen bonds with other amino acids.

3. Phe can undergo oxidation to form Tyr.

4. Lysine has one stereocenter (chiral center).

Explanation:

Serine and glutamine are the polar amino acids with uncharged side group. Serine has a "CH2OH" group as its side chain and the presence of hydroxyl group makes it a polar amino acid. Glutamine is one of the amides derived from other amino acids present in proteins.  

Leucine is a nonpolar amino acid with an aliphatic side chain and tends to cluster within the proteins to stay away from the surrounding watery medium. Its aliphatic R group does not form any hydrogen bonds to other amino acids.  

Phenylalanine is a nonpolar amino acid with an aromatic R group. Oxidation of aromatic R group of phenylalanine converts it into tyrosine which has an additional hydroxyl group in its side chain.

The chiral center is the carbon to which four different functional groups are bonded. The central alpha carbon atom of lysine is bonded to an amino group, carboxyl group, a hydrogen atom, and one positively charged R group which in turn makes it a chiral center.  

You might be interested in
Many bacteria, including E. coli, are capable of growing under both anaerobic and aerobic conditions. Some mutations are introdu
Sloan [31]

Answer:

Due to inability to survive in aerobic condition.

Explanation:

The strain dies when exposed to a normal laboratory atmosphere instead of nitrogen gas atmosphere because the mutation causes change in the capability of the strain to survive in the aerobic conditions. This mutation inactivate several enzymes which is also responsible for their capabilities of surviving under both anaerobic and aerobic environment so that's why the strain dies when exposed to normal atmosphere..

5 0
3 years ago
Which organelle is most like a factory delivery driver?
Zanzabum

Answer:

cytoplasm

Explanation:

3 0
3 years ago
Read 2 more answers
Which of the following is not an endangered species?
vladimir2022 [97]
I think the answer might be giant otter , but not sure
8 0
2 years ago
Read 2 more answers
IS THIS A B C D ?? SOME INE HELP PLSS
AlexFokin [52]
It would be B im pretty sure bro
4 0
3 years ago
Read 2 more answers
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
Other questions:
  • Which characteristic best describes a tropical climate zone.
    7·1 answer
  • Which statements about viruses are true? Select all that apply. A. Viruses are ultramicroscopic cells. B. Viruses are infectious
    9·2 answers
  • In which step of translation does the tRNA become charged? a.initiation b.activation c.elongation
    11·1 answer
  • Match the following.
    6·1 answer
  • What is the importance of the sequence of nucleotides in genetic information?
    12·1 answer
  • Alzheimer's disease is a type of _______________ in which an individual's ability to retrieve memories gradually becomes serious
    15·1 answer
  • Asexual reproduction produces
    6·2 answers
  • Water molecules have a strong attraction to one another.
    10·2 answers
  • Pls hurry!!! if u can’t see the pic don’t bother answering
    10·2 answers
  • What do prokaryotes lack that are in eukaryote cells?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!