1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tamaranim1 [39]
3 years ago
12

What is one way in which viruses commonly enter the body?

Biology
1 answer:
Pavlova-9 [17]3 years ago
4 0
Hmm cuts or maybe actually i am not quite sure myself. :l 
lol
You might be interested in
Which sequence of RNA transcribed from the base sequence of DNA is ATA CCG ATC GAT
HACTEHA [7]

Answer:

a

Explanation:

this image shows what each letter changes to.

6 0
3 years ago
Read 2 more answers
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
What makes up a community?
serg [7]

Answer:

an interacting group of various species in a common location

Explanation:

7 0
3 years ago
Where is the ovary derived from in a flower? Explain how this process happens.
neonofarm [45]

Pollination occurs when pollen grains from the anther land on a stigma. After pollen grains land on the stigma, a pollen tube grows from the pollen grain, through the style, and into the ovary. Sperm cells inside the pollen grain travel down the pollen tube and into the ovary which contains the ovules.

5 0
3 years ago
Why is terrestrial radiation weaker than solar radiation
umka2103 [35]

Answer:

Hence, incoming solar radiation passes through the atmosphere quite freely, whereas terrestrial radiation emitted from the Earth's surface is absorbed and reemitted in its upward passage through the atmosphere.

Explanation:

3 0
3 years ago
Other questions:
  • All the biological macromolecules contain Carbon, hydrogen and oxygen. However, most do not contain nitrogen. The category that
    15·2 answers
  • What statement best describes all enzymes
    14·2 answers
  • Which of the following choices is not a key characteristic to differentiate cancer cells from normal cells?
    12·1 answer
  • In a given hybridization between two flowers, red "R" is dominant, and white "r" is recessive. In a cross between two white-flow
    14·2 answers
  • What is the angle of tilt of the Earth’s axis?
    9·1 answer
  • Gene splicing is used to produce
    9·1 answer
  • How were humans made
    8·1 answer
  • 12. Which of the following information is given to participants in clinical trials as part of obtaining informed consent?
    5·1 answer
  • A 50 gram glass holds 400 grams of liquid water and 75 grams of ice. After 20 minutes the mass of ice is 50 grams. Calculate the
    11·1 answer
  • Why Should We Add Crickets In Our School Lunches? <br> Introduction
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!