1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
professor190 [17]
3 years ago
14

True or false: antibodies are produced and secreted by white blood cells

Biology
2 answers:
neonofarm [45]3 years ago
7 0

Answer:

true

Explanation:

lord [1]3 years ago
6 0

True

B lymphocytes produce antibodies - proteins (gamma globulins) that recognize foreign substances (antigen) and attach themselves to them. B lymphocytes (or B cells) are each programmed to make one specific antibody.

You might be interested in
What is a Constant? In a scientific form
RoseWind [281]

Answer:

The part that does NOT change during an experiment.

Explanation:

Because that's what a constant is. I think this is what you meant by this question.

4 0
3 years ago
Read 2 more answers
What is always true of scientific practices a. They prove a hypothesis to be correct b. They involve steps performed in the same
babymother [125]

Answer:

C. They seek to produce verifiable data.

Explanation:

  • The goal of scientific research is to produce scientific knowledge.
  • The process that scientists follow to generate this scientific knowledge is called the scientific method.
  • The scientific method involves:
  • Making an observation regarding natural phenomena.
  • Formulating a hypothesis that offers a potential explanation for the phenomena.
  • The hypothesis is then tried and tested through experimentation.
  • A substantiated and unfalsified hypothesis turns into a theory.
  • A theory is universal, substantiated and supported by a large body of evidence. One of the major characteristics of a theory is its reproducibility which means that theory produces verifiable data that can be used to reproduce same or similar results.
3 0
3 years ago
Why mesophyll cell is considered as parenchyma cell​
VladimirAG [237]

Answer:

Mesophyll is not a tissue technically speaking. It's just a place, a specific area. Or you can even think of it as the set of all tissues in a given area.

6 0
2 years ago
The triose phosphate produced by photosynthesis can be used to form macromolecules needed by the plant to grow. The formation of
Triss [41]

The formation of macromolecules from triose phosphate is likely anabolic and would be coupled to ATP -> ADP.

Anabolic is a group of metabolic pathways that builds compounds out of smaller building blocks. These reactions, which are often referred to as endergonic processes, demand energy. Catabolism is the breakdown component of metabolism, whereas anabolism is the building component. Typically, anabolism and biosynthesis go hand in hand. Anabolism can be seen in the growth of muscle mass and the mineralization and development of bones. Proteins are broken down into amino acids during catabolic events, as are glycogen and triglycerides into glucose and fatty acids, respectively. Fundamentally, catabolism entails disassembling complex molecules to produce energy that may be utilised by the organism. By building larger, more complex molecules from smaller, simpler ones, anabolism is the exact reverse of catabolism. The body typically stores them for later use.

Learn more about anabolic here:

brainly.com/question/16793262

#SPJ4

3 0
1 year ago
Which of the following statements is incorrect in regards to sensory
Basile [38]

Answer:

1.Sensory receptors are structures in your sense organs that react to a physical

stimulus in the environment.

Explanation:

Hope it helps.

6 0
3 years ago
Other questions:
  • Predict the most likely observed level of luciferase activity if plasmid pCDγ3-789 is introduced into nonlymphoid cells such as
    13·1 answer
  • ​By convention, it has been determined that alpha levels should be set no larger than ____.
    10·1 answer
  • What is the creation of an opening into a brain ventricle called?
    9·1 answer
  • Use the following information for this question: Phenylketonuria is considered to be an inborn error of metabolism. It is a rece
    12·1 answer
  • when you sweat a lot the water content of your blood can drop. your cells have to maintain a certain level of water and salt in
    12·1 answer
  • What are some adaptations of flower petals to help attract pollinators
    11·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Males and females have the same endocrine glands except for the
    15·1 answer
  • Which feature separates humans from other primates?
    15·2 answers
  • The structures of the dermal and vascular systems work together to transport and provide materials essential for photosynthesis.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!