1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
wel
3 years ago
11

2) A segment of DNA that is artificially created from two or more organisms, through use of DNA enzymes in a laboratory is calle

d A) a clone. B) a vector. C) plasmid DNA. D) recombinant DNA.
Biology
2 answers:
MAXImum [283]3 years ago
5 0
How about "recombinant DNA?" Which is the result of DNA cloning as ttom suggests.

wlad13 [49]3 years ago
5 0

Answer:

D) recombinant DNA

Explanation:

   Recombinant DNA are DNA molecules produced from the artificial combination of DNA sequences from different sources. The central technique of recombinant DNA methodology is molecular cloning. Recombinant DNA technology is a set of techniques that allow DNA manipulation.

You might be interested in
How are carbohydrate polymers formed? by hydrolysis by dehydration synthesis by replication by transcription
kenny6666 [7]
I think the correct answer from the choices listed above is the second option. Carbohydrate polymers are formed by dehydration synthesis. In this process, <span>monomers combine with each other via covalent bonds to form </span>polymers<span>. Hope this answers the question.</span>
6 0
3 years ago
Read 2 more answers
No net primary production occurs __________. below the ocean depth where light is 1% of surface light below the compensation dep
olga55 [171]
No net primary production occurs BELOW THE OCEAN DEPTH WHERE LIGHT IS 1% OF SURFACE LIGHT.

Net primary production = <span>gross photosynthetic carbon fixation - the carbon respired to support maintenance requirements of the whole plant.

In short, net primary production is the "available" carbon left for to aid in plant growth and consumption of other heterotrophic organisms.</span>
3 0
3 years ago
1. To be regarded as safe, a sewage system must
wel

Answer:

c

Explanation:

6 0
2 years ago
Grizzly bears: As predators, bears eat several species, like moose and elk. They also eat many fruits throughout the ecosystem.
Anuta_ua [19.1K]

Your teacher likes to copy. Found this at https://examples.yourdictionary.com/examples-of-keystone-species.html


Grizzly bears: As predators, bears keep down the numbers of several species, like moose and elk. They also carry and deposit seeds throughout the ecosystem. Bears that eat salmon will leave their dropping and the partially eaten remains that provide nutrients such as sulfur, nitrogen and carbon to the soil.  

6 0
2 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
2 years ago
Other questions:
  • The restriction enzymes of bacteria protect the bacteria from successful attack by bacteriophages, whose genomes can be degraded
    11·1 answer
  • Suppose a researcher wants to know whether a high protein diet causes children to learn better in school. half of the children i
    7·1 answer
  • 40 POINTS
    13·2 answers
  • Why Lamarckism was rejected after darwinism?
    15·1 answer
  • Which statement best distinguishes plant cells and animal cells?
    10·2 answers
  • Need help quick! will mark brainlist!
    11·1 answer
  • All of the following are examples of ways in which your body will have to maintain homeostasis while running a marathon EXCEPT A
    5·1 answer
  • DNA: TAC GCG TAC CGG ATC<br> mRNA: <br> Amino acids: HELP[
    9·1 answer
  • Which process best explains how antibiotic resistance in bacteria can occur?
    12·1 answer
  • Which of the following is part of the Moneran Kingdom?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!