1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
saw5 [17]
4 years ago
11

It takes 15 electricians 24 days to wire a new housing subdivision. how many days would 18 electricians require to do the same j

ob
Mathematics
2 answers:
monitta4 years ago
8 0

Answer:

<u>20 days</u>

Step-by-step explanation:

24*15=30

360/18=20 days

Romashka [77]4 years ago
4 0
15 electricians worked for 24 days to the whole job, now, there are 15 of them, so on any given day, each electrician worked one whole day, in 24 days, that one electrician worked 24 days total.

now, there were 15 electricians on any given day though, since each one of them worked the whole day that one day, so the "days work worth" on a day is 15, so the house gets 15days worth of work because of that.

so how many "days worth" did all 15 do on the 24 days, well, 15+15+15+15+15+15+15+15+15+15+15+15+15+15+15+15+15+15+15+15+15+15+15+15, namely 15 * 24, or 360 days worth of work.

since it takes 360 days worth of work to do the whole wiring, in how many days would 18 electricians do it?   360/18.
You might be interested in
enter an internet value that could be used in each of the blanks below to make the polynomial factorable
NeX [460]
1. 4
2. 8

These are the only possible answers
7 0
3 years ago
GEOMETRY EASY QUESTION PLEASE HELP (I'm overthinking)
Anettt [7]

Answer: True

Step-by-step explanation: the red line is basically there to throw you off <CDA and <BDA are equal

7 0
3 years ago
one side of a triangle is 6 meters more than twice the shortest side. the third side is 9 meters more than the shortest side. th
Svetach [21]

Answer:

Step-by-step explanation:

Was going to get y’all there in

6 0
3 years ago
What is the value of (6a-2)
DanielleElmas [232]
It totally depends on the value of 'a', and if 'a' changes, then (6a-2) immediately changes too. Whatever 'a' is at the moment, (6a-2) is 2 less than 6 times 'a'.
7 0
3 years ago
the two longer sides of a triangle measure 22 units and 29 units .which of the following is a possible length of the shorter sid
Tresset [83]
B is the right answer because a is too short and c and d are too long
7 0
4 years ago
Other questions:
  • What is the slope of a line that is perpendicular to the line whose equation is 5y+2x=12?
    10·1 answer
  • A building 82 ft high casts a 205-ft shadow. Sarah casts a 10-ft shadow. The triangle formed by the building and its shadow is s
    15·2 answers
  • Which of the following is NOT a way you can show that triangles are similar?
    10·2 answers
  • Which term best describes a figure formed by three segments connecting three noncollinear points?
    9·2 answers
  • Two-digit natural numbers are formed, with replacement, from the digits 0 through 9.
    9·1 answer
  • Solve 2(2 - x) less than or equal to -3x - 2 for x
    11·2 answers
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • True or false? If a and b are complementary, then a equals 45 degrees.
    5·1 answer
  • The product of 84.12 and which number will have three decimal places?
    7·2 answers
  • ( brainlies ) Can somebody help me with this?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!