1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AveGali [126]
3 years ago
7

During an assessment of a neonate born at 33 weeks' gestation, a nurse finds and reports a heart murmur. an echocardiogram revea

ls patent ductus arteriosis, for which the neonate received indomethacin. an expected outcome after the administration of indomethacin to a neonate with patent ductus arteriosis is:
Biology
1 answer:
Nina [5.8K]3 years ago
8 0

It can be expected that there will be closure of the patent ductus arteriosus for this is the effect of indomethacin. The adverse effect would include platelet dysfunction, decrease gasto-intestinal motility and an increase in necrotizing enterocolitis. With this, the nurse should anticipate the possible outcomes where there will be increase bleeding time and decrease gastro-intestinal function after giving indomethacin.

 

You might be interested in
The cell or "plasma" membrane is described as a Fluid Mosaic Model. Can you explain what
gizmo_the_mogwai [7]

Answer:The fluid mosaic model describes the cell membrane as a tapestry of several types of molecules (phospholipids, cholesterols, and proteins) that are constantly moving. This movement helps the cell membrane maintain its role as a barrier between the inside and outside of the cell environments.

Explanation:

8 0
3 years ago
Read 2 more answers
PLS HELP
Radda [10]

Answer:

A: DCAB

Explanation:

There are lot of different types of domestic cats nowadays, with the variations coming mostly from mutations and selective breeding. Some cats are very small, some pretty large, some have long fur, some don't have fur (or rather seem like they don't) etc. The Siberian cat weighs 8-17 pounds, British shorthair 7-12 pounds, Turkish van 7-20 pounds, ragdoll 8-20 pounds, with the females being smaller than the males.

6 0
3 years ago
How are sexual reproduction and asexual reproduction different from each other
Elena-2011 [213]

Answer:

Sexual reproduction is the joining of gametes to form a different organism while Asexual reproduction is the duplication of the first organism to form an identical organism.

Explanation:

5 0
3 years ago
Certain insects resemble the twigs of trees. Based on modern evolutionary theory, the most probable explanation for this is that
lilavasa [31]

The answer is D. Predation of insects resembling twigs of trees occurred.

5 0
4 years ago
Discuss the distinct morphological traits associated with bipedalism. Then, discuss one theory for why humans became bipedal.
max2010maxim [7]

Major morphological characteristics The presence of a bicondylar angle, or valgus knee; a more inferiorly placed foramen magnum; a reduced or non posable big toe; a higher arch on the foot; a more posterior orientation of the anterior portion of the iliac blade; a relatively larger femoral head diameter; an increased femoral neck length; and slightly larger and anterior posteriorly elongated femoral condyles.

<h3>What is bipedalism?</h3>

Bipedalism refers to locomotion on two legs (e.g., walking, jogging, running, etc.). Although it is common to see animals standing or walking on two legs, only a few creatures use bipedalism as their primary mode of movement. Animals, such as chimps and gorillas, that temporarily acquire bipedalism in order to execute a specific role engage in a kind of movement known as facultative locomotion.

Bipedalism is not always the fastest or most efficient way to run or walk, but it offers certain benefits over certain specialized kinds of quadrupedalism. It's unclear why early hominins adopted bipedalism. Many ideas, however, contend that environmental selection forces drove the evolution of bipedalism.

learn more about bipedalism refer:

brainly.com/question/19671997

#SPJ4

6 0
2 years ago
Other questions:
  • How does the escape velocity of venus compare to that of mars?
    15·2 answers
  • In carrying out normal activities, cells use oxygen and produce carbon dioxide. The concentration of oxygen is higher in the blo
    7·1 answer
  • 3. In the molecule referred to in the previous question, what is the dominant element attached to
    7·1 answer
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • Of what relevance is dna replication
    8·2 answers
  • Which functional group allows the sugar glucose to dissolve in blood?
    9·2 answers
  • If cells in the process of dividing are subjected to colchicine, a drug that interferes with the functioning of the spindle appa
    13·1 answer
  • Why is energy recycling in living systems important?
    13·1 answer
  • A person who has type AB blood:
    7·2 answers
  • Because identical twins begin as a single fertilized egg that then separates, identical twins share ____ percent of genetic make
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!