1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vagabundo [1.1K]
4 years ago
10

How would you solve that problem

Mathematics
1 answer:
antiseptic1488 [7]4 years ago
7 0
Since you that that line is 180 degrees you can simply do 180-149 and find that the answer is 31 degrees. So you would do 13x+5=31, 31-5=26, 26/13, and then x=2 :)
You might be interested in
At Jones College, there are a total of 100 students.
Art [367]
The answer is 0. BTW THAT IS EASY
5 0
3 years ago
What are the steps needed to solve ⅘ ÷ ⅕ ?
NemiM [27]
“Keep, Change, Flip” so keep the 4/5 then change the •|• and then flip the last fraction to 5/1 and then multiply the fractions like normal
8 0
3 years ago
Look at the triangular prism. Work out the volume of the prism.
xz_007 [3.2K]

Answer:

See explanation

Step-by-step explanation:

The question has missing details, as the diagram of the prism is not shown.

However, I'll solve using a general rule.

The volume of a triangular prism is:

Volume = \frac{1}{2}* b * h * l

Where

b = base

h = height

l = length

Take for instance:

b = 20cm

h = 10cm

l = 5cm

The volume is:

Volume = \frac{1}{2} * 20cm * 10cm * 5cm

Volume = 10cm * 10cm * 5cm

Volume = 500cm^3

Another instance (see attachment).

From the attachment:

b = 4.5cm

h = 5cm

l = 8cm

The volume is:

Volume = \frac{1}{2} * 4.5cm * 5cm * 8cm

Volume = 2.25cm * 5cm * 8cm

Volume = 90cm^3

7 0
3 years ago
3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'
sdas [7]

3. The original sequence

TAC - CGC - TTA - CGT - CTG - ATC - GCT

codes for

tyr - arg - leu - arg - leu - ile - ala

while the mutated sequence codes for

TAC - CGC - TTA - TTA - TTA - CGT - G<u>CT</u> - <u>G</u>CT - ATC - GCT

tyr - arg - leu - leu - leu - arg - <u>ala</u> - ala - ile - ala

There are several frameshift mutations involved here:

• the first inserts 6 bases (TTA - TTA)

• the second inserts 1 base (G) before the CTG triplet (underlined)

• the third inserts 2 bases (CT) after the CTG triplet

4. The original sequence is the same as before. The mutated sequence

TAC - CGC - TAA - TTA - TTA - CGT - G<u>CT</u> - <u>G</u>CT - ATC - GCT

codes for

tyr - arg - STOP - leu - leu - arg - ala - ala - ile - ala

Then

• there is a (nonsense) point mutation that swaps T for A in the original TTA triplet (nonsense since it produces a stop codon that would halt replication/expression)

• there is a frameshift mutation that inserts 3 bases (TTA)

as well as two other frameshift mutations that also occurred in the previous part.

7 0
3 years ago
I have rope 12m long. I cut it into pieces that are each 2m long. What fraction of the rope is one prices.
emmasim [6.3K]
1/6 because __|__|__|__|__|__|
when you divide 12 meter into 2m long pieces it creates 6 sections so 1 piece out of six is 1/6
5 0
3 years ago
Other questions:
  • I need help plz answer before Monday 26th
    11·1 answer
  • elena finds that the area of a house on a scale drawing is 25 square inches. the actual area of the house is 2,025 square feet.
    15·2 answers
  • 3x - 2 = -3x + 1<br> solve?..
    5·2 answers
  • 6+[(16-4)÷(2²+2)]-2​
    8·2 answers
  • Help me please guys thanks
    9·1 answer
  • I need help with this please mathematics
    13·1 answer
  • Which equation has a value greater than -6 and less than 15?​
    8·1 answer
  • A hiker climbed up from the bottom of a mountain. His elevation increased at a rate of 40 feet each hour. Which equation models
    5·2 answers
  • Rachel types 50 words per minute. She needs to type a 1,500 word report. Determine how many minutes it will take her to type the
    12·2 answers
  • QUESTION: WHATS BETTER <br><br> APPLE JUICE OR ORANGE JUICE
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!