1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Otrada [13]
3 years ago
11

Which branch of science was newly developed after the discoveries about DNA

Biology
2 answers:
Llana [10]3 years ago
8 0
Genetic Engineering Would Be The Answer.
miskamm [114]3 years ago
3 0
That would be genetic engineering. This study involves the use of DNA and genes.
You might be interested in
Ice floats on water. for most other substances however, the solid sinks in the liquid. classify each of these statements as true
PolarNik [594]

Answer:

Ice floats on water.  <em>True</em>

For most other substances however, the solid sinks in the liquid. <em>True</em>

Explanation:

The amount of matter in a certain volume is known as density. Density also determines how close together molecules are in a substance. In general, molecules that form solids are close together, which means that they are more dense than liquids, and this causes them to sink.

Water is a little different. When water becomes a solid, it is called ice. And the molecules of ice are organized in a way that makes them less dense than water. This means that ice floats on water.

7 0
3 years ago
Read 2 more answers
Which of the following provides the best evidence for the idea that multicellular organisms are composed of highly organized arr
djverab [1.8K]
Option A
             This option represents only chloroplast which is a cell organelle.

Option B
             This option only talk about cell division.

Option C
             This option is related to cellular respiration which is carried out in mitochondria.

Option D
             It tells us that different tissues are connected like bone connect with muscle cells.

Conclusion
              The correct option is D which provide the best evidence for the idea that multi cellular organisms are composed of organized arrangements of differentiated cells.

<span />
4 0
4 years ago
Read 2 more answers
WILL MARK BRAINIEST/21POINTS) Give an example of how natural selection could BENEFIT A SPECIES. Justify your response in two or
kotykmax [81]
Galapagos finches all have different types of beaks. During droughts, the finches with the larger beaks survived better than those with smaller beaks. This is because during rainy times, more small seeds were produced and the finches with smaller beaks survived better.<span>
</span>
6 0
4 years ago
When a cell copies its DNA (replication), the original DNA ladder is broken apart and new nucleotides are added to the center. T
VladimirAG [237]

1. TTGCATGCTAGCTACGTGTACGTACCGATGCG

2. GGGCCCATACGTACATGCATGCAGCATATAGC

3. GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

You should double check those to make sure I didn't make any mistakes. Hope this helps!

5 0
3 years ago
Why is water called a universal solvent?
ioda
It is called a universal solvent because it dissolves more substances than any other liquid. It can dissolve a huge variety of substances.
5 0
3 years ago
Read 2 more answers
Other questions:
  • How are winds formed
    5·2 answers
  • According to the cladogram, which organisms are in the smallest clade with birds? mc011-1.jpg
    11·2 answers
  • Can ir spectroscopy be used to distinguish 2-pentanone from 2-hexanone why or why not
    13·1 answer
  • You are given two solutions containing different purified DNAs. One is from the bacterium P. aeruginosa and has a G + C composit
    14·1 answer
  • What cell structure helps the cell stay flexible and maintain homeostasis?
    9·1 answer
  • Which vascular plant organ is most dependent on surface area to carry out its<br> function?
    8·1 answer
  • Please help me with this
    14·1 answer
  • Chlorophyll is necessary for photosynthesis to take place because it-
    15·1 answer
  • Write a pragraph summarizing the main functions of the digestive system. Will give branliest.
    9·1 answer
  • Make a claim about how light moves through different materials. A claim is a statement that you can prove with evidence. Use evi
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!