1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Thepotemich [5.8K]
3 years ago
5

When a cell copies its DNA (replication), the original DNA ladder is broken apart and new nucleotides are added to the center. T

his creates two exact copies, each one made from half the original DNA molecule.
• DNA polymerase (the enzyme which builds DNA) will only attach bases which match with the original strand of DNA.
• In DNA replication, Adenine and Thymine will bong together and Cytosine and Guanine will bond together.
• When creating the matching stand the following pairing rules must be used:
A? T
C? G
Directions: Use the base pairing rules above to figure out the sequence of the new strand of DNA for the original strands below.

1. AACGTACGATCGATGCACATGCATGGCTACGC
2. CCCGGGTATGCATGTACGTACGTCGTATATCG
3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT
4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG
5. CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Biology
1 answer:
VladimirAG [237]3 years ago
5 0

1. TTGCATGCTAGCTACGTGTACGTACCGATGCG

2. GGGCCCATACGTACATGCATGCAGCATATAGC

3. GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

You should double check those to make sure I didn't make any mistakes. Hope this helps!

You might be interested in
Describe the functioning of Golgi apparatus in animal cells.
alina1380 [7]
In the final stage of transport through the Golgi apparatus, modified proteins and lipids are sorted in the trans Golgi network and are packaged into vesicles at the trans face. These vesicles then deliver the molecules to their target destinations, such as lysosomes or the cell membrane.
4 0
3 years ago
Qué significa cada derecho de la sexualidad​
TEA [102]

Answer:

Los Derechos Sexuales se refieren a la libertad de las personas para ejercer su sexualidad de manera saludable, sin ningún tipo de abuso, coerción, violencia o discriminación.

Explanation:

3 0
3 years ago
A hydraulic system uses a(n) ____________________ to transmit pressure.
MrRissso [65]

Answer:

B. fluid

Explanation:

Uses Pascal's law

7 0
3 years ago
Read 2 more answers
Graphic Organizer: Cell Membrane
Simora [160]

The cell membrane maintains homoeostasis in the body which is the  process by which cell maintains a fairly constant environment.

<h3>What is the cell membrane?</h3>

The cell membrane is a lipid bilayer membrane which separates the contents of a cell from the external environment.

The correct graphical chart is as follows:

  • cell membrane maintains homeostasis
  • active transport requires energy
  • passive transport does not require energy
  • Diffusion occurs either through osmosis or facilitated diffusion
  • facilitated diffusion occurs through protein channels
  • Osmosis involves movement of water
  • Endocytosis is the process the cell takes in substances into its inner compartment
  • Exocytosis is the process the cell takes in substances into its inner compartment
  • Pinocytosis is cell drinking
  • Phagocytosis is cell eating

Therefore, the process by which cell maintains a fairly constant environment is called homoeostasis and is maintained by the cell membrane.

Learn more about cell membrane at: brainly.com/question/1768729

#SPJ1

4 0
2 years ago
How are animal like and plant like protests are similar and different
QveST [7]

Answer:The main way animal-like protists differ from plant-like protists is in the way they get energy. Animal-like protists are heterotrophs. ... Plant-like protists, on the other hand, are autotrophs. They can make their own energy from the sun or other sources just as plants can.

Explanation:

6 0
3 years ago
Other questions:
  • A natural color mutation occurs in a species of red beetles, causing some of them to be green in color. These bugs exist in a gr
    13·2 answers
  • 1. What is matter? (Points : 1)
    9·2 answers
  • Which is a function of the collecting ducts? which is a function of the collecting ducts? absorb electrolytes actively and water
    10·1 answer
  • Dogs and cats are classified in what kingdom and what species
    6·1 answer
  • How does melanin relate to light energy and skin cancer?
    12·1 answer
  • What is the Thin layer around the earth in witch all living organisms exist
    5·1 answer
  • Sort the properties to describe each of the three domains. Some of the properties may be used more than once.
    10·1 answer
  • It is possible for a repressor to negatively regulate the expression of an operon because: A. the repressor-binding site overlap
    12·1 answer
  • Air contains carbon dioxide, nitrogen, noble gases, oxygen and water vapour. Give three differences between the composition of t
    13·2 answers
  • Which of the following describes proper microscope care and technique?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!