1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Thepotemich [5.8K]
3 years ago
5

When a cell copies its DNA (replication), the original DNA ladder is broken apart and new nucleotides are added to the center. T

his creates two exact copies, each one made from half the original DNA molecule.
• DNA polymerase (the enzyme which builds DNA) will only attach bases which match with the original strand of DNA.
• In DNA replication, Adenine and Thymine will bong together and Cytosine and Guanine will bond together.
• When creating the matching stand the following pairing rules must be used:
A? T
C? G
Directions: Use the base pairing rules above to figure out the sequence of the new strand of DNA for the original strands below.

1. AACGTACGATCGATGCACATGCATGGCTACGC
2. CCCGGGTATGCATGTACGTACGTCGTATATCG
3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT
4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG
5. CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Biology
1 answer:
VladimirAG [237]3 years ago
5 0

1. TTGCATGCTAGCTACGTGTACGTACCGATGCG

2. GGGCCCATACGTACATGCATGCAGCATATAGC

3. GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

You should double check those to make sure I didn't make any mistakes. Hope this helps!

You might be interested in
During cellular respiration, chemical energy is converted to cellular energy.
Vladimir [108]

Answer:

False, chemical energy is not transfered or converted into cellular energy

Explanation:

6 0
3 years ago
Which star has an temperature of 10,000 K and a Luminosity of 10^2
MaRussiya [10]

Answer:

i think White Dwarf

Explanation:

We are given that the star has a temperature of 10,000 K and a luminosity of 10^2. According to the HR diagram, a star with the surface temperature of 10,000 K would be a white dwarf and if the star were on the main sequence, then it would have a luminosity nearly 100 times more than that of the sun. However since the actual luminosity is 10,000 times smaller than this, this star must be a white dwarf since it has 10,000 K and 100 aka 10^2 luminosity

4 0
2 years ago
During the process of dna replication, the strand provides a blueprint for the production of a new complementary strand, resulti
KatRina [158]

The two DNA strands unwind from one another during semi-conservative replication, and each serves as a template for the synthesis of a new, complementary strand. Two DNA molecules are produced as a result, each with one original and one new strand.

The act of duplication is referred to as replication. DNA replication is the first step in inheritance in molecular biology. The central dogma explains how the DNA replicates itself, codes for the RNA during transcription, and then codes for the proteins during translation.

On several sources of replication along the DNA template strand, DNA replication takes place (antinsense strand). One original strand and one freshly synthesized strand are included in every copy. Although it should be guaranteed that both copies are identical, Each strand of the double helix would act as a template for the manufacture of a new strand, according to the structure of DNA (which was discovered by James D. Watson and Francis Crick in 1953). The process by which freshly created strands united with template strands to create two double helix DNA molecules was unknown.

Click here to learn more about replication.

brainly.com/question/16464230

#SPJ4

3 0
1 year ago
How do you write an expression for "the product of 11 and w."?
yarga [219]
11w
11(w)
11×w
that a few different ways
4 0
3 years ago
You have an unknown piece of matter in front of you that you believe to be a piece of bark from a tree. First, how would you det
natali 33 [55]

Answer:

<em>TO Determine whether Organic or not Just take some crystals on the end of a spatula and then introduce it in a flame, if it is melts or burns without white vapors then it is an inorganic compound and if you see white vapors or smoky vapors, it is organic. This is a very basic test which is used for this purpose.</em>

<em />

<em>idk the second  one..</em>

<em />

5 0
3 years ago
Other questions:
  • How does the rate differ in the presence of a catalyst?
    9·1 answer
  • What technology advancement was necessary before scientists could begin to observe cells
    7·1 answer
  • the type of wound healing that occurs when a wound is sutured is what healing second intention or third intention or first inten
    7·1 answer
  • In humans, the 22 matching chromosomes are called?
    15·1 answer
  • What is the name of the structure that connects the arteriole and venule sides of a capillary bed?
    12·1 answer
  • A pronoun which points out a particular person, place, or thing is a:
    14·1 answer
  • The Rh factor identifies the presence of the rhesus protein in blood. The Rh factor can be represented by a + or – sign. It is i
    8·2 answers
  • What is an indirect measure of the amount of energy released from food?​ a. ​The increase in heat given off when the food is bur
    13·1 answer
  • 30 POINTS PLEASE HELP
    6·1 answer
  • The consumption of carbohydrates is most likely to:.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!