1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Thepotemich [5.8K]
2 years ago
5

When a cell copies its DNA (replication), the original DNA ladder is broken apart and new nucleotides are added to the center. T

his creates two exact copies, each one made from half the original DNA molecule.
• DNA polymerase (the enzyme which builds DNA) will only attach bases which match with the original strand of DNA.
• In DNA replication, Adenine and Thymine will bong together and Cytosine and Guanine will bond together.
• When creating the matching stand the following pairing rules must be used:
A? T
C? G
Directions: Use the base pairing rules above to figure out the sequence of the new strand of DNA for the original strands below.

1. AACGTACGATCGATGCACATGCATGGCTACGC
2. CCCGGGTATGCATGTACGTACGTCGTATATCG
3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT
4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG
5. CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Biology
1 answer:
VladimirAG [237]2 years ago
5 0

1. TTGCATGCTAGCTACGTGTACGTACCGATGCG

2. GGGCCCATACGTACATGCATGCAGCATATAGC

3. GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

You should double check those to make sure I didn't make any mistakes. Hope this helps!

You might be interested in
How are codominant alleles and incompletely dominant alleles similar how are they different?
KATRIN_1 [288]
Codominance is a form of dominance where alleles of a gene pair in heterozygous is completely expressed resulting to offsprings with a phenotype that is neither dominant or recessive. Incomplete dominance is a form of dominance in which one allele of a specific trait is not completely expressed over its paired allele resulting to a third phenotype in which the physical trait is a combination of the phenotypes of both alleles. Therefore, they are similar in that in both combine homozygous dominant and homozygous recessive. They are different in that in codominance shows both, heterozygous while incomplete dominance shows mixture or blend, new trait and heterozygous.
3 0
2 years ago
1. Which of the following best explains why a cell needs ATP?
Vladimir [108]

Answer:

Explanation: rnvnuvibleruvbvuheowibvuivwencjerijedneieru freck you

6 0
3 years ago
How does lymph return to the circulatory system from the lymphatic system? (2 points)
zhannawk [14.2K]

Answer:

It drains into a larger lymph trunk, which returns it to the subclavian veins.

Explanation:

5 0
2 years ago
Read 2 more answers
The ___________________ is a system of structures that includes the ____________. This system has been implicated in ___________
Anna007 [38]

Answer:

The limbic system is a system of structures that includes the amygdala. This system has been implicated in emotion behavior.

Explanation: Hello! I answered your question but know how to explain. :)

6 0
2 years ago
How did the invention of the microscope contribute to knowledge about 1p living things?​
natita [175]

Answer:

It made it possible for people to discover and learn about cells.

Explanation:

The cell is the basic unit of structure and function of all living beings. A cell can also be defined as a morphological, functional, and reproductive unit of all living beings.

Every living organism is made up of one or more cells. All cells are created from an existing cell. A cell is the smallest unit that has all the characteristics of life. A set of cells of similar or the same appearance, embryonic origin, and function is called tissue.

The science that studies the cell is called cytology. There are organic and inorganic compounds in the cell. Of the inorganic compounds, water and salts are the most common. Organic compounds in the cell contain carbohydrates, fats, and proteins.

3 0
2 years ago
Other questions:
  • The aurora borealis is caused by the ______.
    13·2 answers
  • Long-term marijuana use may result in __________, even long after one stops using.
    7·1 answer
  • What is the end product of the process of respiration? *
    7·2 answers
  • Hairy stems (H) are dominant in tomato plants. Hairless stems (h) are present in tomato plants that are homozygous recessive for
    13·1 answer
  • The bean sprouts available at the grocery store are white or colorless, not green. Why? Chlorophyll is not synthesized in bean s
    13·1 answer
  • Passive transport can only occur when there is a concentration gradient of low to high for a substance?
    8·1 answer
  • Ddt is harmful to the environment because it
    7·1 answer
  • You have been called for a​ 6-year-old male patient with shortness of breath. On​ scene, you find the patient with a runny nose
    9·1 answer
  • What source of protein is best adapted for future consumption, taking these trends into consideration?
    10·1 answer
  • What is the term that scientist use to describe the origin of life on earth from nonliving matter
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!