1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Thepotemich [5.8K]
3 years ago
5

When a cell copies its DNA (replication), the original DNA ladder is broken apart and new nucleotides are added to the center. T

his creates two exact copies, each one made from half the original DNA molecule.
• DNA polymerase (the enzyme which builds DNA) will only attach bases which match with the original strand of DNA.
• In DNA replication, Adenine and Thymine will bong together and Cytosine and Guanine will bond together.
• When creating the matching stand the following pairing rules must be used:
A? T
C? G
Directions: Use the base pairing rules above to figure out the sequence of the new strand of DNA for the original strands below.

1. AACGTACGATCGATGCACATGCATGGCTACGC
2. CCCGGGTATGCATGTACGTACGTCGTATATCG
3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT
4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG
5. CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Biology
1 answer:
VladimirAG [237]3 years ago
5 0

1. TTGCATGCTAGCTACGTGTACGTACCGATGCG

2. GGGCCCATACGTACATGCATGCAGCATATAGC

3. GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

You should double check those to make sure I didn't make any mistakes. Hope this helps!

You might be interested in
Does land ice or sea ice have a greater impact on sea level rise?
Karo-lina-s [1.5K]

Answer:

Sea ice has a greater impact on sea level rise than land ice. Sea ice is much more variable in volume and mass than land ice, which is relatively fixed. As a result, sea ice has a greater impact on sea level rise.

Explanation:

7 0
2 years ago
It is easy, please help!!!!! ASAP
zloy xaker [14]
1. best fit line
2. x axis
3. y axis
4. controlled variables
5. (0,0)
6. y intercept
7. 0.00g
3 0
3 years ago
The graph shown includes the number of sunspots observed through 2014 and predicts future sunspot activity through 2019. Based o
olga2289 [7]

Answer: The answer is D. There Would be a general decrease in the Ultrviolet radiation experienced by Earth

Explanation: I took the Study Island quiz and i got it Correct

7 0
3 years ago
Bacteria reproduce by dividing in two. If the bacteria has a dominate trait of causing elevated temperature in the recipient cel
nasty-shy [4]

Bacteria multiply by binary fission, which results in exact copies (clones) of the parent cell. There for B, 100 would be the answer.

7 0
3 years ago
Organisms that cannot make their own food and must obtain energy from external sources are called _______
Alborosie

Answer:

Heterotrophs

Explanation:

Autotrophs are organisms that are able to use a source of energy such as sunlight, to produce their own food. Heterotrophs cannot produce their own food and must rely on the foods they ingest for energy. 

8 0
3 years ago
Other questions:
  • How does the location of a biome impact the climate?
    5·1 answer
  • Which term defines a well tested,scientifically supported statement that explains how something works
    13·1 answer
  • What is the general term for any carbohydrate monomers
    12·2 answers
  • Refraction occurs when light's ___________________ changes. A speed B direction C amplitude D color
    6·1 answer
  • Is a nucleic acid that contains the genetic information for heredity in most organisms.
    5·2 answers
  • 5c. Two parents, a heterozygous normal female and a male who is
    14·1 answer
  • Squirrels eat acorns. Good acorn production happens when there are good growing conditions for the oak trees that make acorns. O
    5·1 answer
  • In around 50 years, the peppered moth population changed from nearly all light wings to nearly all dark wings. Explain exactly h
    9·1 answer
  • What are three ways mutations can occur<br>I will give brainlest answer​
    7·2 answers
  • arrange the organisms from fastest to slowest based on the the time theyd take to complete the 20th carnegie stage
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!