1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Thepotemich [5.8K]
2 years ago
5

When a cell copies its DNA (replication), the original DNA ladder is broken apart and new nucleotides are added to the center. T

his creates two exact copies, each one made from half the original DNA molecule.
• DNA polymerase (the enzyme which builds DNA) will only attach bases which match with the original strand of DNA.
• In DNA replication, Adenine and Thymine will bong together and Cytosine and Guanine will bond together.
• When creating the matching stand the following pairing rules must be used:
A? T
C? G
Directions: Use the base pairing rules above to figure out the sequence of the new strand of DNA for the original strands below.

1. AACGTACGATCGATGCACATGCATGGCTACGC
2. CCCGGGTATGCATGTACGTACGTCGTATATCG
3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT
4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG
5. CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Biology
1 answer:
VladimirAG [237]2 years ago
5 0

1. TTGCATGCTAGCTACGTGTACGTACCGATGCG

2. GGGCCCATACGTACATGCATGCAGCATATAGC

3. GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

You should double check those to make sure I didn't make any mistakes. Hope this helps!

You might be interested in
How does species interaction encourage or slow changes in species ?
ohaa [14]

here is your answer dear friend❤❤❤

8 0
3 years ago
Define the five systems. Be sure to include enough information to distinguish each system from the others. (Site 1)
VladimirAG [237]
By definition, a body system is primarily comprised of different organs and tissues that work one another to achieve a common body process. These body systems would include:

Circulatory system - concerns with the circulation of blood
Digestive system - breaking down of food particles 
Skeletal system - composed of bone structures serving as our body's framework
Nervous system - composed of nerve cells that responds to different stimuli
Respiratory system - concerns of utilising the entry of oxygen and the exhalation of carbon dioxide.
7 0
3 years ago
Read 2 more answers
What is the most essential element in bone marrow ?
drek231 [11]

Answer:

red blood cells, white blood cells, or platelets. Yellow bone marrow is made mostly of fat and contains stem cells that can become cartilage, fat, or bone cells. Enlarge. Anatomy of the bone.

3 0
2 years ago
Read 2 more answers
Why is it important to balance majority rule with minority rights
qaws [65]
<span>Majority rule is a way of organizing government where citizens freely make political decisions through voting for representatives. The representatives with the most votes then represent the will of the people through majority rule. Minority rights are rights that are guaranteed to everyone, even if they are not a part of the majority. These rights cannot be de eliminated by a majority vote. Minorities must trust that the majority will keep in mind the wishes of the minority when making decisions that affect everyone. The minority today will not necessarily be the minority of tomorrow.</span>
7 0
3 years ago
Provide three examples of habitat protection for bats.
KengaRu [80]

Answer:

Explanation:

reduced pesticides

protect water quality

promote natural bat habitat

6 0
3 years ago
Other questions:
  • How are sperm cells transmitted? And how does a condom prefent sperm cells in transmitting?
    7·1 answer
  • Most Swiss starlings produce four to five eggs in each clutch. Those producing fewer or more than this have
    8·1 answer
  • 15. DNA replication is said to be semi-conservative. What does that mean?
    6·1 answer
  • Burning fossil fuels always produce___
    5·2 answers
  • Solve 3x-8=-2 then once you find the value of x, substituted it into x-6
    6·1 answer
  • What is the biggest animal that lives underground?
    6·1 answer
  • The..............is the sense organ most associated with balance.
    5·1 answer
  • Which of the following is a characteristic of attention deficit/hyperactivity disorder (AD/HD)?
    12·2 answers
  • 1 point
    9·1 answer
  • Describe how home heating and cooling has changed over time, and how it has remained the same.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!