1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Thepotemich [5.8K]
3 years ago
5

When a cell copies its DNA (replication), the original DNA ladder is broken apart and new nucleotides are added to the center. T

his creates two exact copies, each one made from half the original DNA molecule.
• DNA polymerase (the enzyme which builds DNA) will only attach bases which match with the original strand of DNA.
• In DNA replication, Adenine and Thymine will bong together and Cytosine and Guanine will bond together.
• When creating the matching stand the following pairing rules must be used:
A? T
C? G
Directions: Use the base pairing rules above to figure out the sequence of the new strand of DNA for the original strands below.

1. AACGTACGATCGATGCACATGCATGGCTACGC
2. CCCGGGTATGCATGTACGTACGTCGTATATCG
3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT
4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG
5. CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Biology
1 answer:
VladimirAG [237]3 years ago
5 0

1. TTGCATGCTAGCTACGTGTACGTACCGATGCG

2. GGGCCCATACGTACATGCATGCAGCATATAGC

3. GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

You should double check those to make sure I didn't make any mistakes. Hope this helps!

You might be interested in
Which of the following factors is used to distinguish the two main aquatic biomes?
Rus_ich [418]
The answer is D. Salt levels. 
5 0
3 years ago
Read 2 more answers
Which of the following is an accurate description of an adult stem cell?
frosja888 [35]
I believe the answer is C). My reason for this is because multipotency stands for multidifferentiative potential. And this is the ability to generate progeny of quite a few distinct cell types. And adult stem cells have that ability. Hope this helps.
4 0
3 years ago
Do stomata close when there is a lack of water in soil or a lack of carbon dioxide in the atmosphere?
Arte-miy333 [17]

<em>When water is abundant:</em>

-Temporal regulation of stomata is used:

Open during the day

Closed at night

- At night, there is no photosynthesis, so no demand for CO2 inside the leaf.

- Sunny day = demand for CO2 in leaf is high = stomata wide open.

- As there is plenty of water, plant trades water loss for photosynthesis products.

-  If the leaf's CO2 concentration is low, the stomata will stay open to continue fueling photosynthesis.

- High temperatures will also signal stomata to close.

- When limited water is available in the soil, plants try to prevent water loss.

5 0
4 years ago
A person whose red blood cells agglutinate with anti-B antibodies BUT NOT anti-A antibodies is type _________.
asambeis [7]

A person whose red blood cells agglutinate with anti-B antibodies BUT NOT anti-A antibodies is type AB.

<h3>What is an agglutinate?</h3>

Agglutination is the process by which specific antibodies to antigenic components on the surface of red blood cells or inert particles (direct agglutination) or to antigenic components adsorbed or chemically attached to red blood cells or inert particles produce clumps of cells or inert particles (passive hemagglutination and passive agglutination, respectively).

When antibodies on one RBC attach to the antigen on another RBC, a process known as agglutination, globular to amorphous, grape-like aggregates of RBCs are formed. RBC agglutination supports immune-mediated hemolytic anemia when it is present (IMHA). The majority of IMHA instances do not exhibit agglutination, but when it does, immunoglobulin M (IgM) is the most frequently implicated because of its pentavalent nature. Agglutination, however, might be brought on by a very thick IgG antibody coating of the RBC membranes. Agglutination is typically regarded as IMHA's diagnostic sign.

Learn more about Agglutination here:

brainly.com/question/13022582

#SPJ4

6 0
2 years ago
How are sexual reproduction and asexual reproduction different from each other
Elena-2011 [213]

Answer:

Sexual reproduction is the joining of gametes to form a different organism while Asexual reproduction is the duplication of the first organism to form an identical organism.

Explanation:

5 0
3 years ago
Other questions:
  • The production of endogenous very low-density lipoproteins (vldls) is decreased by
    10·1 answer
  • A star has a mass that is 1/5 that of earths sun. What will happen to the star as it ages? It will become a _____. A. Neutron st
    8·1 answer
  • A man who is an achondroplastic dwarf with normal vision marries a color-blind woman of normal height. the man's father was six
    12·1 answer
  • Which is the term for the process of organ formation in an embryo?
    11·2 answers
  • Name a source of heat within earth
    13·2 answers
  • Based on his experiments, Mendel concluded that each trait was controlled by two _____.
    14·2 answers
  • In order to produce a current, there must be a change of the magnetic field. ture or f
    14·1 answer
  • Which two kingdoms include both one-celled and many-celled organisms?
    15·1 answer
  • The complete genetic makeup of an organism is referred to as its.
    12·1 answer
  • Which of the following statements is TRUE?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!