1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Thepotemich [5.8K]
3 years ago
5

When a cell copies its DNA (replication), the original DNA ladder is broken apart and new nucleotides are added to the center. T

his creates two exact copies, each one made from half the original DNA molecule.
• DNA polymerase (the enzyme which builds DNA) will only attach bases which match with the original strand of DNA.
• In DNA replication, Adenine and Thymine will bong together and Cytosine and Guanine will bond together.
• When creating the matching stand the following pairing rules must be used:
A? T
C? G
Directions: Use the base pairing rules above to figure out the sequence of the new strand of DNA for the original strands below.

1. AACGTACGATCGATGCACATGCATGGCTACGC
2. CCCGGGTATGCATGTACGTACGTCGTATATCG
3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT
4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG
5. CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Biology
1 answer:
VladimirAG [237]3 years ago
5 0

1. TTGCATGCTAGCTACGTGTACGTACCGATGCG

2. GGGCCCATACGTACATGCATGCAGCATATAGC

3. GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

You should double check those to make sure I didn't make any mistakes. Hope this helps!

You might be interested in
Sugar dissolves readily in water because it is a(n) ____ substance
Strike441 [17]
It is an hydrophilic substance....<span>Substances that have charge or polarity are </span>hydrophilic<span>, and are likely to dissolve because they have either full or partial charge areas to form hydrogen bonds with water molecules.</span>
7 0
3 years ago
Read 2 more answers
I’ll mark brainiest if your right need ASAP
BabaBlast [244]

Answer:

the answer is the 1st one

Explanation:

7 0
3 years ago
Read 2 more answers
Which act prompted the developers to install stormwater management systems to handle the movement of polluted water?
Gre4nikov [31]
Natural landscapes such as forests, the soil absorbs much of the stormwater and plants help hold stormwater close to where it falls. In developed environments, unmanaged stormwater can create two major issues: one related to the volume and timing of runoff water (flooding) and the other related to potential contaminants that the water is carrying (water pollution).
6 0
3 years ago
Read 2 more answers
Which accurately describes gymnosperms? Check all that apply. Some of them lose their leaves in winter.Some of them lack seeds.S
AleksandrR [38]
I think that correct answers are:
<span>Some of them lose their leaves in winter. (i.e. <span><em>Larix</em></span>)</span>
<span>They include the tallest plants (i.e<em>.Sequoia)

</em>I don't think they are the oldest type of seed plants, since in the past the classes like progymnosperms and seed ferns existed prior to the gymnosperms. But question isn't absolutely clear to me and I can't be 100% sure.
All of the gymnosperms have seeds unless human grows some seedless variant.
Gymnosperms don't have flowers like angiosperms do, but some people think that cone is kind of flower.
Male cones produce pollen, not female.
Hope I helped :)
<em /></span>
7 0
3 years ago
Read 2 more answers
The part of earth that contains the air we breathe ?
Crank
This question is pretty vague and confusing.
3 0
3 years ago
Other questions:
  • Why are some sources of sugar better than others?
    10·1 answer
  • The cross bridge cycle starts when _________.
    11·1 answer
  • Minerals absorbed by the roots are transmitted through the plant in the _______.
    9·2 answers
  • Cellulose, chitin, and peptidoglycan function as structural molecules and withstand pulling and pushing forces well. Which struc
    14·1 answer
  • What type offspring can be expected from a cross between a short plant and heterozygous plant?
    6·1 answer
  • A medical researcher experimented with the effects of calcium intake on the healing time of broken bones. People who had
    8·1 answer
  • What is the function of agarose gel?
    10·1 answer
  • SF medium is a selective medium, developed in the 1940s, to test for fecal contamination of milk and water. Only certain gram-po
    8·1 answer
  • A wind turbine has a rotor blade diameter of 75 meters, how much energy would the turbine generate?
    5·1 answer
  • In all of the following characteristics, prokaryotes differ from eukaryotes except in cell size. nucleic acids as the hereditary
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!