1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Thepotemich [5.8K]
2 years ago
5

When a cell copies its DNA (replication), the original DNA ladder is broken apart and new nucleotides are added to the center. T

his creates two exact copies, each one made from half the original DNA molecule.
• DNA polymerase (the enzyme which builds DNA) will only attach bases which match with the original strand of DNA.
• In DNA replication, Adenine and Thymine will bong together and Cytosine and Guanine will bond together.
• When creating the matching stand the following pairing rules must be used:
A? T
C? G
Directions: Use the base pairing rules above to figure out the sequence of the new strand of DNA for the original strands below.

1. AACGTACGATCGATGCACATGCATGGCTACGC
2. CCCGGGTATGCATGTACGTACGTCGTATATCG
3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT
4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG
5. CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Biology
1 answer:
VladimirAG [237]2 years ago
5 0

1. TTGCATGCTAGCTACGTGTACGTACCGATGCG

2. GGGCCCATACGTACATGCATGCAGCATATAGC

3. GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

You should double check those to make sure I didn't make any mistakes. Hope this helps!

You might be interested in
Once a person is infected, which one of these sexually transmitted infections (stis) remains in the body for life, regardless of
VMariaS [17]
Herpes is the answer.

Hope it helped!
4 0
3 years ago
In 1860, a scientist named Gregor Mendel used pea plants to determine the dominance of certain traits. In one of his experiments
lara [203]
You bring the Y down and the y across the boxes in your punnet square, so all boxes are Yy.
7 0
2 years ago
Identify each event as the result of mechanical weathering or chemical weathering.
kow [346]

<h3><u>The following events are identified as chemical weathering:</u></h3>
  • The minerals in a marble statue react with water to form acids and pores in the structure.
  • The rocks in a region are streaked orange after being exposed to repeated rains.

<em><u>Reason: </u></em>

When the weathering process occurs due to <em>chemical reaction</em>, then it is considered as chemical weathering.

In <em>the first case</em>, minerals of marble statue are <em>reacting</em> with water to cause weathering. In the <em>second case</em>, due to the <em>acidificaion reaction</em>, the change of the color has happened after exposure to the repeated rains.

<h3><u>The following events are identified as Mechanical weathering:</u></h3>
  • A piece of rock crumbles after being constantly thrashed by strong waves.
  • Industrial runoff forms cracks in a rocky structure in its path.

<em><u>Reason:</u></em>

When the rock is broken into simple pieces <em>without any chemical reaction </em>it is considered as mechanical weathering.

In the <em>first cause</em>, due to the <em>abrasion</em> caused by the strong waves, weathering has happened, in the <em>second case</em> industrial run off may be of varying temperature and thus may cause <em>heating or cooling</em> of the rock and causes weathering.

8 0
3 years ago
Complete the graphic organizer to summarize exceptions to Mendels principles
Butoxors [25]

Answer:

<em>Exceptions to Mendel's principles: </em>

Does exceptions mean that Mendel was "wrong"? The answer is "NO". It means that we know more today about diseases, genes, and heredity than compared to what he expalined 150 years ago. Here I have summerized the exceptions with examples:

<em>Incomplete dominance</em>: When an organism is heterozygous for a trait and both genes are expressed but not completely.

<em>Example</em><em>:</em> SnapDragon Flowers

<em>Codominance</em>: When 2 different alleles are present and both alleles are expressed.

<em>Example</em>: Black Feathers + Whites feathers --> Black and white speckled feathers

<em>Multiple alleles</em>: Three or more alternative forms of a gene (alleles) that can occupy the same locus.

Example: Bloodtype

<em>Polygenic traits</em>: more than one gene controls a particular phenotype

Example: human height, Hair color, weight, and eye, hair and skin color.

5 0
3 years ago
Read the scenario below and answer the question that follows.
Afina-wow [57]
I think the correct answer is a
6 0
3 years ago
Read 2 more answers
Other questions:
  • Give five statements about hemoglobin and myoglobin structure that are true?
    7·1 answer
  • Explain why an organism grows in size when its cells can only achieve a certain size.
    12·1 answer
  • A mutation is a mistake or change in the
    13·1 answer
  • Which type of solution would cause a bacterium with a weak or damaged cell wall to burst as water moves into the cell? hints whi
    8·1 answer
  • What is the name of the structure labeled B in the diagram below?
    9·1 answer
  • The dynamo theory states that earths magnetic field is created in the later known as the
    7·2 answers
  • What is the poly name of carbohydrates
    10·1 answer
  • Most fungi are aquatic.<br> True<br> False
    7·1 answer
  • A metabolic waste of algae that can be recycled for use in cellular respiration is A.oxygen
    6·1 answer
  • Which event took place during the Copernican revolution, when most people started to believe in a heliocentric model of the sola
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!