1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Thepotemich [5.8K]
2 years ago
5

When a cell copies its DNA (replication), the original DNA ladder is broken apart and new nucleotides are added to the center. T

his creates two exact copies, each one made from half the original DNA molecule.
• DNA polymerase (the enzyme which builds DNA) will only attach bases which match with the original strand of DNA.
• In DNA replication, Adenine and Thymine will bong together and Cytosine and Guanine will bond together.
• When creating the matching stand the following pairing rules must be used:
A? T
C? G
Directions: Use the base pairing rules above to figure out the sequence of the new strand of DNA for the original strands below.

1. AACGTACGATCGATGCACATGCATGGCTACGC
2. CCCGGGTATGCATGTACGTACGTCGTATATCG
3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT
4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG
5. CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Biology
1 answer:
VladimirAG [237]2 years ago
5 0

1. TTGCATGCTAGCTACGTGTACGTACCGATGCG

2. GGGCCCATACGTACATGCATGCAGCATATAGC

3. GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

You should double check those to make sure I didn't make any mistakes. Hope this helps!

You might be interested in
What does the cell membrane do for the cell?
krek1111 [17]

Answer:

Protection

Explanation:

The plasma membrane, or the cell membrane, provides protection for a cell. It also provides a fixed environment inside the cell. And that membrane has several different functions. One is to transport nutrients into the cell and also to transport toxic substances out of the cell.

3 0
3 years ago
Legumes enrich soil by adding nitrogen to it through their __
USPshnik [31]

They add nitrogen to the soul through their nodules !

3 0
3 years ago
Which RNA nucleotide is complementary to adenine?
Yakvenalex [24]

Answer:

It would be uracil

Explanation:

RNA base pairs:

A - U

G - C

5 0
2 years ago
Read 2 more answers
What's the similarities between phenotype and genotype
kupik [55]
The genotype<span> of an organism is defined as the sum of all its genes. The </span>phenotype<span>of an organism is the observable physical or biochemical characteristics of an organism, determined by both genetic make-up and environmental influences

</span><span>Mark as brainlist if correct please and have a blessed day!
</span>
5 0
3 years ago
Which plant structure is MOST like the hyphae of fungi?
Paraphin [41]

Answer:

The roots as they absorb water and nutrients.

6 0
3 years ago
Read 2 more answers
Other questions:
  • A substance that can not be broken down into any simpler substances is called?
    12·1 answer
  • Where are the coastal areas located that are unlikely to harbor a kelp forest ecosystem? Why do you think this might be the case
    9·1 answer
  • A beer-making microbiologist noticed that no matter how long the brewing process took, 3% alcohol was the maximum produced. Hypo
    12·1 answer
  • Describe the process of inhalation
    7·1 answer
  • Help ueu<br> Sf dg dgnegndgndgndg sfns efngensgnsg eyney.eymn
    6·2 answers
  • How does mutations result in genetic variation
    11·1 answer
  • Why can't humans go through Asexual reproduction?
    10·1 answer
  • In order for a trait to be considered a competitive advantage, the trait must be?
    9·2 answers
  • If a diploid cell has 20 chromosomes, how many chromosomes will be in its haploid cell? If a germ cell has 10 chromosomes, how m
    15·1 answer
  • The growing or farming of marine plants or animals under controlled conditions is called:__________
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!