1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Thepotemich [5.8K]
3 years ago
5

When a cell copies its DNA (replication), the original DNA ladder is broken apart and new nucleotides are added to the center. T

his creates two exact copies, each one made from half the original DNA molecule.
• DNA polymerase (the enzyme which builds DNA) will only attach bases which match with the original strand of DNA.
• In DNA replication, Adenine and Thymine will bong together and Cytosine and Guanine will bond together.
• When creating the matching stand the following pairing rules must be used:
A? T
C? G
Directions: Use the base pairing rules above to figure out the sequence of the new strand of DNA for the original strands below.

1. AACGTACGATCGATGCACATGCATGGCTACGC
2. CCCGGGTATGCATGTACGTACGTCGTATATCG
3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT
4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG
5. CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Biology
1 answer:
VladimirAG [237]3 years ago
5 0

1. TTGCATGCTAGCTACGTGTACGTACCGATGCG

2. GGGCCCATACGTACATGCATGCAGCATATAGC

3. GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

You should double check those to make sure I didn't make any mistakes. Hope this helps!

You might be interested in
Which component of whole blood is primarily responsible for maintaining the pH of blood and body tissues within normal limits?
vredina [299]

Answer:

Plasma.

Explanation:

Plasma is the liquid component or constituent of the blood after the removal of all the cells and platelets. It is composed of 90% water, coagulation factors like antibodies, electrolytes, proteins , lipids e.t.c which help to maintain the blood PH and osmotic balance of the blood during the process of giving viscosity to the blood. The plasma comprises of 55% of the blood.

7 0
3 years ago
I need help with this question please
MA_775_DIABLO [31]

The presence of a tumor in the larynx is known as Laryngeal cancer. It may affect the process of breathing, speaking, and swallowing of the food down to the esophagus.

<h3>What are the properties of a cancerous cell?</h3>

Cancerous cells have numerous properties. Some of them are as follows:

  • It is an undifferentiated cell that continues uncontrolled rapid division and proliferation.
  • It is immortal which means allows the inhibition of apoptosis.
  • It follows the process of metastasis.

Laryngeal cancer disturbs the passage of air in and out of the lungs through the larynx and trachea. The process of migration of cancerous cells from the initial origin to the other connections may describe as metastasis.

Laryngeal cancer is caused primarily by smoking, drinking alcohol, and other age-related issues. The symptoms of this cancer may include voice changes, sore throat, or a cough that resides long away.

Therefore, it is well described above.

To learn more about Cancerous cells, refer to the link:

brainly.com/question/373177

#SPJ1

4 0
2 years ago
A body part that is reduced in size and no longer has a useful function in an organism is called an
miv72 [106K]

Would it be a vestigial remnant? Like the appendix?

3 0
3 years ago
Read 2 more answers
Biology question 3
mamaluj [8]
The muscle cells divide through Mitosis, a cellular division comprised of several other substeps. 

The final step of the cell division is the cytokinesis by which two new cells are formed from cell with a multiple number of nucleus after the replication process. This steps follow the telophase. 
5 0
3 years ago
The three primary pollutant gases are_____
noname [10]
Carbon dioxide
carbon monoxide
sulfer dioxide
5 0
3 years ago
Other questions:
  • If a material contains three elements joined in a fixed proportion it is a
    12·2 answers
  • What is this ???? Who will solve it ?? Solve it quickly
    7·1 answer
  • Which statement is most likely a scientific law? A. Objects that are sitting still tend to stay still until something pushes or
    8·2 answers
  • Which of the following is not true concerning the Pleistocene ice age.
    9·2 answers
  • A type if stem that grows underground
    14·2 answers
  • Define acidity. How is it measured?
    13·1 answer
  • True or false :
    14·1 answer
  • Why do adult stem cells currently have fewer uses in therapeutic cloning than embryonic stem cells? A. Adult stem cells have mor
    10·2 answers
  • Which statement is not true about the field of science?
    15·1 answer
  • Three kinds of _________ molecules carry out genetic instructions for the production of proteins?​
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!