1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Thepotemich [5.8K]
3 years ago
5

When a cell copies its DNA (replication), the original DNA ladder is broken apart and new nucleotides are added to the center. T

his creates two exact copies, each one made from half the original DNA molecule.
• DNA polymerase (the enzyme which builds DNA) will only attach bases which match with the original strand of DNA.
• In DNA replication, Adenine and Thymine will bong together and Cytosine and Guanine will bond together.
• When creating the matching stand the following pairing rules must be used:
A? T
C? G
Directions: Use the base pairing rules above to figure out the sequence of the new strand of DNA for the original strands below.

1. AACGTACGATCGATGCACATGCATGGCTACGC
2. CCCGGGTATGCATGTACGTACGTCGTATATCG
3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT
4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG
5. CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Biology
1 answer:
VladimirAG [237]3 years ago
5 0

1. TTGCATGCTAGCTACGTGTACGTACCGATGCG

2. GGGCCCATACGTACATGCATGCAGCATATAGC

3. GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

You should double check those to make sure I didn't make any mistakes. Hope this helps!

You might be interested in
Appraise the importance of the role that plants play in the water cycle
kodGreya [7K]
Idk....................
4 0
3 years ago
Read 2 more answers
1. breeding of individuals that have genes for two different characteristics dihybrid cross 2. a grid system used to predict pos
icang [17]
1. breeding of individuals that have genes for two different characteristics:
DIHYBRID CROSS.
We call it a dihybrid cross when we are considering a cross between two different traits.
"di" means having two traits involved (for example, trait A and trait B), the "hybrid" means that each trait will have two different alleles (for gene A: A or a; for gene B: B or b), one is dominant and the other is recessive.

2. a grid system used to predict possible combinations of genes due to random fertilization: PUNNETT SQUARE
The Punnett square is a grid system that helps us predict an outcome of a cross or a breeding experiment. We this, we can determine the probability of an offspring having a particular genotype.
This is very useful when we are considering more than one gene,  making it less confusing.

3. a condition in which both alleles are dominant: CODOMINANCE
Tere are alleles that have the capacity of dominating at the same time, and when an organism is heterozygotic, both alleles are expressed.
For example, a white chicken(WW) crossed with a black chicken (BB):  100% of the offspring being WB. With this genotype, they have black feathers and white feathers. It's not a blend of colors, but a case where both are expressing.

4. when more than two alternatives exist for a gene: MULTIPLE ALLELES
Mendel thought that only two possible alternatives could exist for a gene, but there are cases that have more than 3 possibilities. Some of those can be really popular in a population while others not so much.
This happens with rabbit's fur. They can be black, brown, grayish,
Himalayan patterning or white fur.

 5.a condition in which neither pair of alleles is dominant or recessive, so the traits blend in the phenotype: INCOMPLETE DOMINANCE
Some alleles are not completely dominant, and when that's the case the phenotype of a heterozygous organism will be a mix between the phenotypes of its homozygous parents.
For example:
plant 1: RR -red
plant 2: rr-white
By crossing this plants we will obtain 100%  of the offspring with a color mix: pink.(genotype: Rr)
Red and white are not completely dominating so it results in a blend of colors.


3 0
3 years ago
Why do you think Harvey placed the sea urchin cells in a hypersonic solution?​
Marina CMI [18]
I don’t knowjrjdjfjf
8 0
3 years ago
"Bottom-up" (or "data-driven") mechanisms are Group of answer choices
lukranit [14]

Answer: A. mechanisms for which activity is primarily triggered and shaped by the incoming stimulus information.

Explanation:

Bottom-up mechanism is a process in which a body perceives an incoming stimulus and certain physiological changes occurs in the body working in the direction of upwards that is the signals are transferred to the brain so that the brain could interpret the stimulus. This mechanism suggests the fact that our perceptual experience is based upon the sensory stimuli.

4 0
3 years ago
what does cell membrane,meiosis sickle cell anaemia base change and inheritance pattern,DNA,enzymes and aerobic resporation have
timurjin [86]

Answer: Lol

Explanation:

3 0
3 years ago
Other questions:
  • What shape does the DNA molecule have?
    14·1 answer
  • Carbon bonding is almost entirely _____.
    13·2 answers
  • The ocean absorbs carbon dioxide directly from the atmosphere. How does CO2 absorption affect the ocean?
    8·1 answer
  • during the fall season, a lot of leaves on the trees turn lighter green/yellow and then orange/ red. What causes the color to be
    15·1 answer
  • Which best describes the order of the technology used to transmit a sound through the radio? microphone → transmitter → micropho
    12·2 answers
  • You are with a person who is responsive and showing signs and symptoms of a life threatening condition
    14·1 answer
  • What is a secondary crime scene?
    11·1 answer
  • Which of the following is true concerning mangrove forests?
    15·2 answers
  • If the Sun was the size of a weather balloon (about 1.5 meters in diameter), about how far away would Neptune’s orbit be?
    14·1 answer
  • When encountering a powerboat in darkness or reduced visibility, what do visible white and red lights indicate?.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!