Answer:
In 2011 an estimated 1.65% of the US workforce was employed/working in the Agriculture-related sector of the economy
Explanation:
Agriculture has been a major source of jobs for most countries especially with developing/underdeveloped countries ranking in the highest percentage of their country's population working in this sector, while developed countries like the US have smaller percentage of the population working agriculture-related jobs. as of 2011 chad had an estimated 86.67% of their population involved with Agriculture-related jobs
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
B . , because I remember this
1.Reproduction
2.Heredity
3.Variation in fitness or organism
4.variation in individual characters among members of the population
