1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ahat [919]
3 years ago
13

What conditions for organisms to compete in a struggle for existence

Biology
1 answer:
goldfiish [28.3K]3 years ago
3 0
The lack of resources.
You might be interested in
This study is replicated in the Appalachian Mountains with similar results. Which of the following is true? The number of days w
Trava [24]

Answer:

There was no change in the number of days with poor flower availability

Explanation:

When replicating a study, the researcher develops the exact same study (experiment/treatment) in different places (experimental unit). In this case, as the researcher replicates the study in the Appalachian Mountains and gets similar results, that means that there was no change in the number of days with poor flower availability.

8 0
3 years ago
(18pts)
den301095 [7]

The answer is C)Resistant bacteria cannot be attacked by penicillin

4 0
3 years ago
Describe the relationship<br> between variations and<br> adaptations?
laila [671]
Adaptations are physical or behavioral traits that make an organism better suited to its environment. Heritable variation comes from random mutations. Random mutations are the initial cause of new heritable traits. For example, a rabbit can't choose to have a different fur color.
mark brainlist plsss
3 0
3 years ago
What does macromolecule mean?
Gnom [1K]
B a very large molecule made of smaller molecules
8 0
3 years ago
What are the letters that make up the 4 bases in dna?.
Ymorist [56]

Answer:

acgt

Explanation:

adenine, cytosine, guanine, and thymine

4 0
2 years ago
Other questions:
  • How did Daniela Charris become a founder of the Queens Liberation project
    14·1 answer
  • Which organ conrain enzymes capable of digesting carbs, proteins, and lipids?
    5·1 answer
  • The diagram illustrates the water cycle. Which process occurs at location
    9·1 answer
  • in what way does agriculture, lumbering, housing, industrial development, and highway construction affect erosion
    5·1 answer
  • What are some ways that healthcaer professionals can decrease the risk of drug abuse and addiction?
    8·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Which level of classification is the most specific (only one type of organism). How did you come to this answer
    10·1 answer
  • After which event could you say that evolution has occurred?
    6·2 answers
  • in an investigation on accuracy and precision, myriah measures the mass of a 10.00 g piece of metal several times. her measureme
    12·1 answer
  • How do wales differ from fish
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!