1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rzqust [24]
3 years ago
14

How does clear cutting compare with selective cutting, and why is selective cutting considered more sustainable than clear cutti

ng?
Biology
1 answer:
Katyanochek1 [597]3 years ago
4 0
Selective logging—the practice of removing one or two trees and leaving the rest intact—is often considered a sustainable alternative to clear-cutting, in which a large swath of forest is cut down, leaving little behind except wood debris and a denuded landscape
You might be interested in
1. How did dark matter affect the development of structures in the early universe?
-Dominant- [34]

Answer:

1. It seeded the development of galaxies

2. The percentage of dark matter has shrunk in scientists' estimates since the 1980s

The percentage of unknown material has grown in scientists' estimates since the 1970%

3. Supernovae that are moving away at an accelerating rate.

Explanation:

1. How did dark matter affect the development of structures in the early universe?

It seeded the development of galaxies.

It seeded the development of quasars.

It cooled pockets of gas to form nebulae.

it became part of black holes

2. How has scientific understanding about the composition of the universe changed over time? Select the two correct answers.

The percentage of dark matter has shrunk in scientists' estimates since the 1980s

The percentage of unknown material has grown in scientists' estimates since the 1970%

The percentage of ordinary matter has grown in scientists' estimates.

The percentage of dark energy has shrunk in scientists estimates

3. Which is evidence for the existence of dark energy?

Pulsars that seem to be moving closer at an accelerating rate.

Supernovae that are moving away at an accelerating rate.

Black holes that are expanding at a constant rate.

Galaxies that are rotating at a constant rate.

<u><em>Please don't use these answer's to cheat they are to help only.</em></u>

6 0
3 years ago
A marine biologist has dredged up an unknown animal from the seafloor. Describe some of the characteristics that could be used t
jeka57 [31]

Answer:

The first thing to look at would be type of symmetry the organism exhibits. If it is asymmetrical then it would be a sponge and the discovery could stop right there. If not, other characteristics need to be investigated.

Knowing the type of body cavity this organism has would be helpful.

It would also be beneficial to know what type of skeleton (endo or exo) this organism has and what its appendages look like.

Finally, the type of digestive tract and the presence or absence of a head would help to determine what this creature is.

4 0
3 years ago
Theodor Schwann and Matthias Schleiden were major contributors to the Cell Theory as we know it. In 1839 Schwann published a boo
zaharov [31]

Answer:

D

Explanation:

Cells come from free cells

7 0
3 years ago
Read 2 more answers
The white fur of a polar bear is an example of a:
elena55 [62]

Answer:

the answer is A

The bears fur is white to help it blend in and keep warm. suitable for the environment it lives in

3 0
3 years ago
Read 2 more answers
____ is when a(n) ____ makes a species better able to survive and reproduce.
MissTica
D. Homeostasis- naturally selected function
8 0
3 years ago
Other questions:
  • I need some help with an environmental science question.
    13·1 answer
  • 1. If there is not enough carbohydrate intake, how does the body form glucose?
    10·1 answer
  • Which of the following is a true statement?
    11·1 answer
  • a group of of scientists is studying the internal parts of a cell. which microscope is most appropraite for these scientist to u
    5·1 answer
  • What is population ecology?<br> I
    8·2 answers
  • Identify the stages of mitosis .
    12·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Are gender traits completely a result of societal expectations?
    7·1 answer
  • 10) COMPRESSIVE STRESSES, GRANITIC MAGMAS, AND
    15·1 answer
  • By what processes do minerals change?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!