1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elina [12.6K]
3 years ago
8

What is the enthalpy change (in kj) of a chemical reaction that raises the temperature of 250.0 ml of solution having a density

of 1.25 g/ml by 9.20 ∘c? (the specific heat of the solution is 3.74 j/g⋅k.)?
Chemistry
2 answers:
FinnZ [79.3K]3 years ago
4 0

The enthalpy change (in kJ) for the given solution is \boxed{{\text{329}}{\text{.82 kJ}}}

Further explanation:

The property is a unique feature of the substance that differentiates it from the other substances. It is classified into two types:

1. Intensive properties:

These are the properties that depend on the nature of the substance. These don't depend on the size of the system. Their values remain unaltered even if the system is further divided into a number of subsystems. Temperature, refractive index, concentration, pressure, and density are some of the examples of intensive properties.

2. Extensive properties:

These are the properties that depend on the amount of the substance. These are additive in nature when a single system is divided into many subsystems. Mass, enthalpy, volume, energy, size, weight, and length are some of the examples of extensive properties.

Enthalpy:

It is a thermodynamic property that is defined as the sum of internal energy and product of pressure (P) and volume (V) of the system. It is a state function, an extensive property, and is independent of the path followed by the system while moving from initial to the final point. The total enthalpy of the system cannot be measured directly so its change \left({\Delta{\text{H}}}\right) is usually measured.

The enthalpy change \left({\Delta{\text{H}}}\right)can have two values:

Case I: If the reaction is endothermic, more energy needs to be supplied to the system than that released by it. So \Delta{\text{H}} comes out to be positive.

Case II: If the reaction is exothermic, more energy is released by the system than that supplied to it. So \Delta{\text{H}} comes out to be negative.

Specific heat is the amount of heat required to increase the temperature of any substance per unit mass. Specific heat capacity is also known as or mass specific heat. Its SI unit is Joule (J).

The formula to calculate the heat energy of any substance is as follows:

{\text{Q}}={mc\Delta T}}                       …… (1)

Here,

Q is the amount of heat transferred.

m is the mass of the substance.

c is the specific heat of the substance.

{\Delta T}} is the change in temperature of the system.

The formula to calculate the density of the solution is as follows:

{\text{Density of solution}}=\frac{{{\text{Mass of solution}}}}{{{\text{Volume of solution}}}}               ….. (2)

Rearrange equation (2) for the mass of the solution.

{\text{Mass of solution}}=\left({{\text{Density of solution}}}\right)\left({{\text{Volume of solution}}}\right)        …… (3)

The density of the solution is 1.25 g/mL.

The volume of solution is 250 mL.

Substitute these values in equation (3).

\begin{gathered}{\text{Mass of solution}}=\left({\frac{{{\text{1}}{\text{.25 g}}}}{{1\;{\text{mL}}}}}\right)\left({{\text{250 mL}}}\right)\\={\text{312}}{\text{.5 g}}\\\end{gathered}

The temperature change \left({\Delta{\text{T}}}\right) is to be converted to K. The conversion factor for this is,

{\text{0 }}^\circ{\text{C}}={\text{273 K}}

So {\Delta T}} can be calculated as follows:

\begin{gathered}{\text{Temperature}}\left({\text{K}}\right)=\left( {9.2+273}\right)\;{\text{K}}\\=282.2\;{\text{K}}\\\end{gathered}

The mass of the solution is 312.5 g.

The specific heat of the solution is 3.74\;{\text{J/g K}}.

{\Delta T}} of the system is 282.2 K.

Substitute these values in equation (1).

\begin{gathered}{\text{Q}}=\left({{\text{312}}{\text{.5 g}}}\right)\left({\frac{{3.74\;{\text{J}}}}{{\left({{\text{1 g}}}\right)\left({{\text{1 K}}}\right)}}}\right)\left({282.2\;{\text{K}}}\right)\\=329821.25\;{\text{J}}\\\end{gathered}

The enthalpy change is to be converted into kJ. The conversion factor for this is,

{\text{1 J}}={10^{-3}}\;{\text{kJ}}

So the enthalpy change can be calculated as follows:

\begin{gathered}{\text{Q}}=\left({329821.25\;{\text{J}}}\right)\left({\frac{{{{10}^{-3}}\;{\text{kJ}}}}{{{\text{1 J}}}}}\right)\\=329.82125\;{\text{kJ}}\\\approx{\text{329}}{\text{.82 kJ}}\\\end{gathered}

Therefore, the enthalpy change of the given reaction is 329.82 kJ.

Learn more:

1. What is the equilibrium constant of pure water at  ? brainly.com/question/3467841

2. 1. Calculate   for the reaction using Hess law: brainly.com/question/11293201

Answer details:

Grade: Senior School

Subject: Chemistry

Chapter: Thermodynamics

Keywords: intensive, extensive, enthalpy, mass of solution, amount of heat transferred, Q, m, c, given mass, molar mass, enthalpy change, 329.82 kJ, enthalpy change, density of solution, mass of solution, volume of solution, conversion factor, 250 mL, 1.25 g/mL.

Pepsi [2]3 years ago
3 0
<span>250 ml * 1.25 g/ml * 3.74 j/g-K * 9.2 K = 10.752 kJ Pretty much, all you need to do here is multiply all of these out to get your final answer. Not all questions are this easy, but this is certainly one of them.</span>
You might be interested in
Mr. Chem S. Tree added water to 250. ML of a 2.50 M NaOH solution, until the final volume was 500. ML. What is the new molarity
tresset_1 [31]

Answer:

molarity of diluted solution = 1.25 M

Explanation:

Using,          

C1V1 (Stock solution) = C2V2 (dilute solution)

given that

C1 = 2.50M

V1 = 250ML

C2 = ?

V2 = 500ML

2.50 M x 250 mL = C2 x 500 mL

C2 = (2.50 M x 250 mL) / 500 mL

C2 = 1.25 M

Hence, molarity of diluted solution = 1.25 M

4 0
3 years ago
Identify the spectator ions in this reaction. Check all that apply.
balandron [24]
CN, LI are the only two
4 0
3 years ago
Read 2 more answers
DNA instructions: GCCUAAUGCCCGAGUAACACC GGU TRANSCRIBE THE ABOVE DNA PATTERN into mRNA message​
Katarina [22]

CGGAUUACGGGCUCAUUGUGGCCA

7 0
3 years ago
Nitric oxide (NO) reacts readily with chlorine gas as follows.2 NO(g) + Cl2(g) equilibrium reaction arrow 2 NOCl(g)At 700. K the
Yanka [14]

<u>Answer:</u>

<u>For a:</u> The mixture will need to produce more reactants to reach equilibrium.

<u>For b:</u> The mixture will need to produce more reactants to reach equilibrium.

<u>For c:</u> The mixture will need to produce more products to reach equilibrium.

<u>Explanation</u>:

For the given chemical equation:

2NO(g)+Cl_2(g)\rightleftharpoons 2NOCl(g)

The expression of K_{p} for above equation follows:

K_{p}=\frac{(p_{NOCl})^2}{(p_{NO})^2\times p_{Cl_2}}   .....(1)

We are given:

Value of K_p = 0.26

There are 3 conditions:

  • When K_{p}>Q_p; the reaction is product favored.
  • When K_{p}; the reaction is reactant favored.
  • When K_{p}=Q_p; the reaction is in equilibrium.

For the given options:

  • <u>For a:</u>

We are given:

p_{NOCl}=0.11atm\\p_{NO}=0.16atm\\p_{Cl_2}=0.30atm

Putting values in expression 1, we get:

Q_p=\frac{(0.11)^2}{(0.16)^2\times 0.30}=1.57

As, K_{p}; the reaction is reactant favored

Hence, the mixture will need to produce more reactants to reach equilibrium.

  • <u>For b:</u>

We are given:

p_{NOCl}=0.048atm\\p_{NO}=0.12atm\\p_{Cl_2}=0.10atm

Putting values in expression 1, we get:

Q_p=\frac{(0.048)^2}{(0.12)^2\times 0.10}=1.6

As, K_{p}; the reaction is reactant favored

Hence, the mixture will need to produce more reactants to reach equilibrium.

  • <u>For c:</u>

We are given:

p_{NOCl}=5.20\times 10^{-3}atm\\p_{NO}=0.15atm\\p_{Cl_2}=0.15atm

Putting values in expression 1, we get:

Q_p=\frac{(5.20\times 10^{-3})^2}{(0.15)^2\times 0.15}=0.008

As, K_{p}>Q_p; the reaction is product favored.

Hence, the mixture will need to produce more products to reach equilibrium.

8 0
3 years ago
A scientist has found two samples of radioactive material. The first sample has a mass of 1.0 g and an activity of 2.0 mc022-1.j
Degger [83]
1.5 g is your answer 
4 0
3 years ago
Read 2 more answers
Other questions:
  • How does energy transform during solar power process
    5·1 answer
  • Why are the carboxylic acid groups of the amino acids so much more acidic (pka~ 2) than a carboxylic acid such as acetic acid (p
    6·1 answer
  • For what reasons would modern scientists accept dalton's atomic theory but not the idea of an atom proposed by the greek philoso
    13·1 answer
  • OCAS GAME
    11·1 answer
  • How is salt water classified?
    9·1 answer
  • Which is the most chemically active of all the elements?
    12·2 answers
  • What is a sensory neuron?
    7·1 answer
  • ANSWER ASAPP GIVING BRAINLIEST AND STUFF!
    12·1 answer
  • How does the law of conservation apply to chemical reactions.
    11·1 answer
  • Calculate the mass of copper that could be made from 4.0g of copper oxide
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!