1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
emmasim [6.3K]
3 years ago
10

Examples of matter and not

Biology
1 answer:
OleMash [197]3 years ago
7 0
Well matter is basically any substance that has mass and takes up space. Example, you have a ball, or a table, or anything really. That is mass. But anything that doesn't take up space or has mass isn't matter. So, anything that doesn't have a mass or take up space is not matter. Hope this helped you understand. :D
You might be interested in
If a diploid cell has 12 chromosomes, how many chromosomes will each of its haploid daughter cells have after cell division?
never [62]
It would have c 12 chromosomes
5 0
3 years ago
The wolf is an ancient predator. It is a social animal, traveling as a family made up of a mated pair, and the pair's adult offs
-Dominant- [34]
D. wolves catch prey by hunting in packs trust me i got it right

7 0
3 years ago
PLS HELP ASAP
Crazy boy [7]
E. All of the above.
3 0
3 years ago
Read 2 more answers
In addition to glucose and chloride, which electrolyte is a component of peritoneal dialysate fluid?
pentagon [3]

In addition to glucose and chloride, other electrolytes that are components of peritoneal dialysate fluid are magnesium, sodium, and calcium.

<h3>What are electrolytes?</h3>

Electrolytes are solutions or molten substances which conduct electricity as a result of ions present in the them.

The ions present in body fluids such as blood and interstitial fluid are known as electrolytes.

The peritoneal diasylate fluid contains several electrolytes such as chloride, sodium, calcium and Magnesium.

Therefore, electrolytes are present in body fluids.

Learn more about body electrolytes at: brainly.com/question/13484762

#SPJ11

4 0
2 years ago
How is the major conflict developed in the middle and how is the conflict resolved in the end
Kamila [148]
What is the question or paper? there isn’t really a question here if there is nothing to look at lol
7 0
3 years ago
Read 2 more answers
Other questions:
  • En la raza de ovejas Rommey Marsh, un gen conocido como gris letal, provoca que el feto gris GG, muera antes de las 15 semanas d
    5·1 answer
  • What type of turtle do you think this is?
    8·1 answer
  • During the process of chromosome replication, A genetic error occurs. As a result, a sequence of events occurs as described belo
    13·1 answer
  • how do you think plant cells differ from animal cells? (Hint: what can plants do that animals cannot?
    15·2 answers
  • The science and tools used to advance agriculture are known as?
    11·1 answer
  • How did the skeleton change during bird evolution?
    5·1 answer
  • Embryonic stem cells have the potential to?
    10·1 answer
  • Which of the following is NOT a factor of sustainability?
    12·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • How is zero, oxidation numbers, and noble gases related​
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!