1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
patriot [66]
3 years ago
12

What is the difference between a hypothesis and a theory?

Biology
1 answer:
vampirchik [111]3 years ago
7 0

Answer: I think the answer is A. because I remember doing it when we were still in school I chose A. and I got a 100%.

You might be interested in
Molecular phylogenies show all land plants are a monophyletic group. This suggests ________.
guapka [62]

Answer:

D.  There was a single transition from aquatic to terrestrial habitats

Explanation:

Based on the molecular differences at the level of DNA sequence and inheritance, the molecular phylogenies show that all land plants are a monophyletic group. This is why it suggests a single transition from aquatic to terrestrial habitats occur.

5 0
3 years ago
In ________ matter flows from one trophic level to another, and
Vika [28.1K]
1 is the answer because it’s talking about chemical
5 0
3 years ago
Which of the following is a beneficial characteristic of plastic grocery bags?
diamong [38]

B. Frequently Reused

8 0
4 years ago
Read 2 more answers
Finger like extensions of the amoebas cytoplasm are called?
KonstantinChe [14]

they are called
pseudopodia

hope it helped :)

7 0
3 years ago
Read 2 more answers
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer
quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

5 0
3 years ago
Other questions:
  • What is the term usedfor an organism’s ability to maintain stable internal conditions even when its outside enviorment changes?
    8·2 answers
  • The earliest hominin that belonged to the same genus as modern humans was probably
    12·1 answer
  • Are humans and mammals the same? fact:
    11·2 answers
  • How is mass affected by the location of an object in space?
    5·1 answer
  • The hereditary material that encodes the genetic information that makes up our genes is
    6·2 answers
  • Which phrase best describes the main function of the stomach? A. contracts to move substances through the body B. provides struc
    9·2 answers
  • What is the green pigment called?
    11·1 answer
  • Principles of Ecology: Part 4 FANR/MARS 1100 Law of Tolerance Survival depends on _________________________ of many factors, whi
    11·1 answer
  • Give two examples of adaptations that can help a species survive<br><br> please fast
    15·2 answers
  • Helppppopoo plssssssssssss!!!!!:(
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!