1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
GREYUIT [131]
3 years ago
10

Which activity do all living things do to survive? Carry out photosynthesis Take in energy reproduce hunt for a mate

Biology
1 answer:
Juli2301 [7.4K]3 years ago
6 0
All organisms must take in energy and reproduce.

Photosynthesis is a form of taking in energy.  Hunting for a mate is a step some organisms take in the process of reproduction.
You might be interested in
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
Which of the following is an adaptation that helps to defend an organism against consumers?
sweet-ann [11.9K]

Answer:

some plants have thorns some animals have spikes

Explanation:

5 0
3 years ago
Read 2 more answers
What processes turn atmospheres into clouds
bulgar [2K]

Answer:

am sorry I don't know this

5 0
3 years ago
Which of the following is likely the direct source of energy to move the sailboat? A, sun B. Wind. C. Moving sails D, Moving wat
ser-zykov [4K]
The direct source of energy to move the sailboat is probably wind, since wind is what pushes the sail of the sailboat, which is what propels the sailboat forward. 

Hope this helps!
5 0
3 years ago
Is a desk being pushed by a student
Vsevolod [243]
Answer: a) applied force

Explanation: the student is applying force onto the desk when they push it.
5 0
3 years ago
Other questions:
  • Which of these accurately describes the process of translation?
    7·1 answer
  • Fossils are related to evolution justify this statement
    15·1 answer
  • I did an experiment on the enzyme catalase. The aim was to determine effect of temperature on enzyme catalase. I was told a hypo
    7·1 answer
  • A scientist is studying a gene known as the XYZ gene in eukaryotes. Into a eukaryotic cell, she inserts an miRNA that is complem
    10·1 answer
  • The nurse is caring for a female client with dysmenorrhea that interferes with activities of daily living. the client is prescri
    13·1 answer
  • What does the bacterial cell,human cell and plant cell have in common?
    7·2 answers
  • 10 points
    10·1 answer
  • Which of the following is not a useful scientific field for providing evidence of evolution?
    14·1 answer
  • What is the scientific term for the repeatability of findings?
    14·1 answer
  • Read this excerpt from We've Got a Job.
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!