1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
LekaFEV [45]
3 years ago
15

Do you think you would like to analyze dna samples? why or why not?

Biology
2 answers:
dimaraw [331]3 years ago
5 0
No, its not my field of interest.

velikii [3]3 years ago
5 0

I would like to analyze DNA. I think that it is cool how you can do so many things with it. You can replicate it. It can provide curtail evidence in cases. You can still get results with only a few skin cells. I think that there is a lot to learn in this field and hope to learn more in the future.

You might be interested in
In order for any animal to grow, repair its body, reproduce and carry out daily activities it must have energy. When an animal d
stealth61 [152]

Answer:

Hungry!

Explanation:

4 0
3 years ago
How do biotic and abiotic factors affect the characteristics of an ecosystem
valina [46]

Explanation:

Biotic factors such as the presence of autotrophs or self-nourishing organisms such as plants, and the diversity of consumers also affect an entire ecosystem. Abiotic factors affect the ability of organisms to survive and reproduce. Abiotic limiting factors restrict the growth of populations.

3 0
3 years ago
[BWS.02]Which of these questions can be answered through science?
GREYUIT [131]

Answer:

Is wood heavier than paper

Explanation:

This is the only question that can have a definite answer and not an opinionated response

5 0
3 years ago
Read 2 more answers
Why are seed plants an evolutionary advantage?
lara31 [8.8K]
Seed plants have an evolutionary advantage for several reasons. For one, the seeds can disperse easily. Furthermore, seeds can time their germination. For example, some seeds only germinate when they experience a period of being frozen.
5 0
3 years ago
Read 2 more answers
Fragmenting one large park or preserve into many small parks with human habitation in between them is most likely to lead to whi
barxatty [35]

Answer:

The correct answer is a. Reduction in species diversity

Explanation:

In habitat fragmentation, the large area of forest is divided into many smaller patches which reduce the area of habitat for species live there. This Fragmentation of habitat occurs mainly due to human activities like making highways and roads in the area.

This separates species member from each other which reduces the gene flow between that which can lead to inbreeding depression in a species and extinction of species can occur.  

Cutting trees and human activities can alter the environment negatively which can cause extinction of some species that reduce species diversity. So the correct answer is a.

3 0
3 years ago
Other questions:
  • Surgeons use succinylcholine, which is an acetylcholine analog, as a muscle relaxant. care must be taken because some individual
    13·1 answer
  • What is the description of insertion in science terms and what is the outcome
    5·1 answer
  • Where are earthquakes and volcanoes most likely to occur
    12·2 answers
  • Since plant cells do not have centrioles, how do they make spindle fibers during mitosis?
    8·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Why is it important for scientists to develop a way to grow tissues that have a built-in system to supply blood
    13·2 answers
  • Detailed environmental reconstructions, based on fossil animal bones, of the Daka Member of Ethiopia’s Middle Awash deposits .
    8·1 answer
  • This is when atoms of elements combine by sharing electrons or by the complete transfer of electrons from one atom to another
    12·1 answer
  • How does natural selection cause populations to change over time.
    15·1 answer
  • What does maintaining structure mean for organisms and reproduction​
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!