1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
charle [14.2K]
3 years ago
11

When an automotive battery is fully charged,the sulfuric acid and water mixture will have a specific gravity of about

Biology
2 answers:
Slav-nsk [51]3 years ago
8 0

Answer:

1.3

Explanation:

avanturin [10]3 years ago
6 0
When an automotive battery is fully charged, the sulfuric acid and water mixture will have a specific gravity of about 1.3. Specific gravity is actually the difference in the weight of water in comparison to a specific fluid. It is measured by a hydrometer. The amount of charge in the battery is normally measured by the specific gravity of the battery. The specific gravity of water is 1 and anything less than one is considered less dense while anything that has a specific gravity of more than 1 is considered more dense than water.


You might be interested in
List 5 types of evidence used by scientists to support evolution.
Nata [24]

Answer:

Five types of evidence for evolution are discussed in this section: ancient organism remains, fossil layers, similarities among organisms alive today, similarities in DNA, and similarities of embryos.

Explanation:

hope it helps!

8 0
2 years ago
The greenhouse effect is
svlad2 [7]

Answer:

The greenhouse effect is

A) human activity has no effect on elements, chemical compounds, and other forms of matter.

B) living organisms are not limited by any one nutrient.

<u>C) nutrients are circulated throughout the biosphere. </u>

D) many nutrients do not reach toxic concentrations in the biosphere.

Explanation:

3 0
3 years ago
1- In a species of mice, brown fur color is dominant to white fur color. When a brown mouse is crossed with a white mouse all of
yan [13]
The offspring did not have white fur due to the fact that white fur is a recessive trait. One parent had brown fur, which is a dominant trait, that cancels out the recessive trait and that is why the offspring did not have white fur.
4 0
3 years ago
Who wants to attack Tartuffe, but is restrained by Dorine?
Leokris [45]
Damis, Orgon's son, wants to attack Tartuffe at the beginning of the Third Act (Scene 1). He acts irrationally and wants to prevent the marriage of his sister Marianne to Tartuffe, arranged by his father. However, the servant Dorine prevents him from acting stupid. She has another plan: they would trick Tartuffe into trying to seduce Elmire, Orgon's wife, so that he might see what a scoundrel Tartuffe really is.
7 0
3 years ago
To find out if light is necessary for photosynthesis​
Stolb23 [73]

Answer:

yes

Explanation:

light is main source of energy for photosynthesis to take place

if you recall photosynthesis cannot take place without light

even in dark reaction , light reaction has to produce ATP and reduced NADH which dark reaction will use .

4 0
3 years ago
Read 2 more answers
Other questions:
  • If the secondary consumer has 30 kcal of available energy, how much does the tertiary consumer receive?
    6·1 answer
  • What are the role of all four types of lipids: fats, phospholipids, waxes, and steroids.
    8·1 answer
  • IN THE RESPIRATION EQUSTION DOES ENERGY ACT AS A REACTAN OR PRODUCT
    10·1 answer
  • Describe the structure and function of the health team
    6·2 answers
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • Why you observe the shine of a mineral sample which property are you measuring ?A) Color B) Streak C) Cleavage D) Luster...pleas
    15·2 answers
  • Of all the species you observed in this lab, which is the most difficult to classify as fungus-like, plant-like, or animal-like?
    9·1 answer
  • What type of element(s) would be expected to form first from a subatomic particle explosion? choices are heavy elements, iron, o
    13·2 answers
  • A boundary formed when two plates move past each other
    14·2 answers
  • Eukaryotic cells produce new cells for growth and repair through a cell division process known as.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!