1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Darina [25.2K]
4 years ago
5

What nursing action is the priority for a client in the second stage of labor?

Biology
1 answer:
Margarita [4]4 years ago
6 0
Assessing the perineum for bulging is a nursing priority to a client at the second labor stage. A bulging perineum is caused by the presence of the fetal head against the perineal area and usually signifies imminent birth. Pain medication is not administered this close to the birth instead it crosses the placenta barrier and can cause respiratory distress in the newborn. During this second stage of labor the client is encouraged to push, not pant, with each contraction.
You might be interested in
What is needed for natural selection to occur? Select all that apply.
DIA [1.3K]
These are the answers to thisA C D E
5 0
4 years ago
Suppose the inputs and outputs to the atmospheric carbon reservoir each year were as shown below. How much carbon would the atmo
defon

The correct answer is - A. 780 GtC.

If the inputs and outputs of carbon are as shown on the image, than the carbon levels in the atmosphere will reduce by 20 GtC in a ten year time, thus making the atmosphere have 780 GtC instead of the initial 800 GtC.

On the image we can see that the carbon that gets up into the atmosphere is 69 GtC annually, while the carbon that returns on the Earth is 71 GtC annually. That means a drop of 2 GtC annually in the carbon levels in the atmosphere.

Such a process will reduce the Greenhouse effect, and eventually it will lead to an ice age because the atmosphere will not be able to retain as much heat as previously, thus the Earth will cool off.

7 0
3 years ago
A codon is a set of three nucleotides that correspond to a specific amino acid. The table below shows various DNA codons and the
Finger [1]

Answer:

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d. The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

2. Below is a table for the genetic code:

T

C

A

G

T

TTT Phe (F)

TTC "

TTA Leu (L)

TTG "

TCT Ser (S)

TCC "

TCA "

TCG "

TAT Tyr (Y)

TAC "

TAA Stop

TAG Stop

TGT Cys (C)

TGC "

TGA Stop

TGG Trp (W)

C

CTT Leu (L)

CTC "

CTA "

CTG "

CCT Pro (P)

CCC "

CCA "

CCG "

CAT His (H)

CAC "

CAA Gln (Q)

CAG "

CGT Arg (R)

CGC "

CGA "

CGG "

A

ATT Ile (I)

ATC "

ATA "

ATG Met (M)

ACT Thr (T)

ACC "

ACA "

ACG "

AAT Asn (N)

AAC "

AAA Lys (K)

AAG "

AGT Ser (S)

AGC "

AGA Arg (R)

AGG "

G

GTT Val (V)

GTC "

GTA "

GTG "

GCT Ala (A)

GCC "

GCA "

GCG "

GAT Asp (D)

GAC "

GAA Glu (E)

GAG "

GGT Gly (G)

GGC "

GGA "

GGG "

a. The following codons can be mutated by one base to produce an amber codon:

CAG    Gln

AAG    Lys

GAG    Glu

TCG    Ser

TTG    Leu

TGG    Trp

TAA    Stop

TAT    Tyr

TAC    Tyr

b. From part a, CAG (Gln) and TGG (Trp) can become amber stop codons through EMS.

c. From part b, both of the resulting amber codons could be suppressed by amber nonsense suppressors generated by EMS.

3a. The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain.  The anticodon is the complementary three nucleotide sequence in the appropriate tRNA.

b. Template strand is the DNA strand off which the mRNA is synthesized.  The coding, or non-template, strand is the DNA strand complementary to the template strand; it has the same sequence (except for T for U substitutions) as the mRNA.

c. The Pribnow box is a sequence of six nucleotides (TATAAT) positioned at -10 that signals where transcription initiation should begin in prokaryotic DNA.  The Shine-Delgarno sequence is a short, purine-rich region in the mRNA that is complementary to the rRNA within the 16S ribosomal subunit.  The sequence signals which AUG acts as the translation start in mRNA.

4a. False, a wobble allows the anticodon in the tRNA to hybridize with different codons in mRNA.

b. False, a frameshift mutation affects all the subsequent amino acids.

c. False, only one codon (AUG) encodes for the start of protein synthesis; three codons signal the end of protein synthesis.

d. False, the wobble is first base (5’ to 3’) in the anticodon.

e. True, RNA can be used as a template for DNA synthesis in a process known as reverse transcription.

f. True.  For example, a single base substitution causing CAT to change to AAT would signal a termination.

g. False, the Wobble Hypothesis explains how alternate base pairing can occur with the first nucleotide (going from 5' to 3') in the anticodon.

5a. Digestion of RNA with alkali will cleave the strand after each 3’ phosphate.  Therefore, the products remaining will consist of pppNp, Np, and N-OH

b. If RNA was synthesized in the 3’ to 5’ direction (i.e. by adding ribonucleotides to the 5’ end), then the pppNp and Np fragments should be labeled with tritium.

c. If RNA was synthesized in the 5’ to 3’ direction (i.e. by adding ribonucleotides to the 3’ end), th

Explanation:

6 0
3 years ago
A myofibril is a cylindrical bundle of contractile myofilaments within the skeletal muscle cell. True or False
r-ruslan [8.4K]

Answer:

True

Explanation:

A myofibril also called muscle fibril found in muscle cells, it is composed of thick and thin filaments of protein Myosin and Actin respectively.

5 0
4 years ago
Read 2 more answers
Which of the following describes an antibiotic that is good for a human to take as a medicine?
natita [175]

Answer:

I would say that the answer is A. So Sorry if I'm wrong, but I'm 99% sure.

Explanation:

3 0
3 years ago
Read 2 more answers
Other questions:
  • What bone runs parallel to the fibula?
    8·2 answers
  • Assume that a single layer of phospholipids coat the water in a beaker. Which part of the phospholipid molecule will face the ai
    10·1 answer
  • Each person in a family has the same traits. There are no differences in traits between parents and Offspring or among siblings.
    8·1 answer
  • How would you expect a bacterium near the end of a binary fission to look
    13·1 answer
  • What would happen if there was no greenhouse effect?
    14·2 answers
  • Match each type of metamorphism with the correct description.
    5·2 answers
  • Most systemic venous blood is both oxygen poor and nutrient poor. However, systemic venous blood that is oxygen not poor and nut
    13·1 answer
  • What would a doctor most likely observe in a patient with a disease affecting the muscular system? ​
    7·1 answer
  • SOMEONE PLZ HELP ME Part B: Evaluating Results
    11·2 answers
  • How are the chromosomes sorted during meiosis
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!