The beneficial uses of bacterial toxins in medicine are more and more used lately. For example, Botulinum toxin is a toxic protein produced by the bacterium Clostridium botulinum which has paralytic effects (injection of this toxin into muscle relax specific muscles). Botulinum toxin accomplishes his effects on the neuromuscular junction where he prevents the release of the neurotransmitter acetylcholine (Ach). Utilization of this toxin is in the treatment of various muscle spasms. It is also used in the treatment of migraines. Diphtheria toxin is also one of the toxins used for medical purposes for the treatment of cutaneous and non-Hodgkin T-cell lymphomas. <span>Some bacterial toxins can be used in the treatment of tumours. For example, immunotoxin, which is protein made by fusion of modified antibody and toxin.The antibody binds to an antigen on the target cell, the toxin then enters via endocytosis and kills the cell. Commonly used bacterial toxins in immunotoxins are Diphtheria toxin and the Pseudomonas exotoxin.</span>
<span>These are viroids. They are some of the smallest types of matter that have been shown to take on the properties of living beings. They have the ability to replicate, while not having many of the mechanisms that are commonly found in DNA and required for them to replicate.</span>
Answer:
B, Isotonic solution
Explanation:
In an isotonic solution, the flow of water in and out of the cell is happening at the same rate.
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
