1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sergeinik [125]
3 years ago
14

How can the mass of a glass of orange juice be increased? By evaporating the orange juice. By freezing the orange juice. By boil

ing the orange juice. None of these will increase the mass.
Biology
1 answer:
geniusboy [140]3 years ago
8 0
Its d. None of these will increase the mass. the mass stays the same whatsoever. it will never change
You might be interested in
Which is one of the five characteristics of life?
Thepotemich [5.8K]
One characteristic of life is that living things have different levels of organization -They have both molecular and cellular organization - They must have the ability to organize simple substances into complex ones. - They organize cells at several types of levels, namely: (a) Tissue- a group of cells that perform a common function (b) Organ - A group of tissues that perform a common function. (c) Organ system- a group of organs that perform a common function. (d) Organism- any complete living thing.
5 0
3 years ago
Read 2 more answers
12. Which of these organisms undergoes the most dramatic changes as it grows
schepotkina [342]

Answer:

C. Caterpillar

Explanation:

6 0
3 years ago
Help me pls fast
scoundrel [369]
X, answer is X, good luck now, pls answer my question pls pls.
8 0
2 years ago
Which enzyme(s) require(s) the addition of HCl for optimum activity?
KengaRu [80]
There are many answer you have to be specific
5 0
3 years ago
Once you have been exposed to an antigen, you develop immunity against the same antigen because
Paha777 [63]
Because an antibody is "made" relative to the antigen, but kept at low levels when you are exposed the first time ("primary immune response"). The second time you're exposed to the same antigen, memory cells recognize it and the body produces a high level of antibodies, and the level of antibodies usually remains higher for a longer time ("secondary immune response"). This is your basic immune response (primary and secondary).

This explains exactly why vaccines are effective to extremely effective.
3 0
3 years ago
Other questions:
  • The osmotic balance between blood and interstitial fluid is maintained by plasma proteins called
    5·1 answer
  • The phrases above are describing what layer of our atmosphere?
    10·1 answer
  • Some steps in mitosis are shown below. They are not in order.
    14·2 answers
  • During the light reaction of photosynthesis, only the electrons of chlorophyll absorb energy and not the protons and neutrons. W
    12·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Which factors caused the rapid decline or decrease of the Sierra Nevada yellow-legged frog population? Check all that apply. fis
    11·2 answers
  • ~~9. genetically speaking, why is it important not to mate with a close relative
    10·2 answers
  • Using the photosynthesis equation, predict how the rate of photosynthesis might change with variation in the following parameter
    5·1 answer
  • Is the Great Green Wall an example of Secondary Succession?
    15·1 answer
  • What is one benefit of having a shorter beak?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!