1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
astraxan [27]
4 years ago
9

Which of the following is an example of technological progress?

Biology
1 answer:
Romashka-Z-Leto [24]4 years ago
7 0
I think the correct answer from the choices listed above is option D. An increase in corn output resulting from genetic engineering, the invention of the air conditioner and the invention of LCD televisions are all example of technological progress. They make use of the present knowledge and making advantage of it to help the lives of people.
You might be interested in
The bones in the wings of birds and bats are _______ because they derived from a _______ ancestor, while the wings are _______ t
dolphi86 [110]
The answer is: homologous; common; homoplastic.

<span>The bones in the wings of birds and bats are <u>homologous</u> because they derived from a <u>common</u> ancestor, while the wings are <u>homoplastic</u> traits. Homologous structures are similar structures shared by different groups and that are derived from a common ancestor. The similar anatomy of bones in the wings of birds and bats is inherited from a common ancestor of tetrapods (to which birds and bats belong). However, wings are not inherited from the common ancestor of birds and bats. Therefore, wins are homoplastic traits (analogous structures) because they have similar function but they are not inherited from the common ancentor.</span>
8 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
4 years ago
The numbers of prey in an area determine the number of predators and vice versa. true or false
kicyunya [14]
The answer is true for this question

4 0
3 years ago
2) what is an example of solute?<br><br> a) acetone<br> b) egg whites<br> c)water<br> d)sugar
kotegsom [21]

Answer:

acetone

Explanation:

4 0
3 years ago
Read 2 more answers
Proteins that are embedded through the plasma membrane are ...
djverab [1.8K]
Transport proteins- an example of a protein in the plasma membrane is integral proteins, which main function is to transport molecules across the membrane. Hope this helps :)
3 0
3 years ago
Other questions:
  • Different environments can be affected by various types of pollution. How would bacteria and algae in a pond kill fish and other
    6·1 answer
  • Identify the correct statements about Lesch-Nyhan syndrome.
    6·1 answer
  • How are amino acids held together?
    11·2 answers
  • Why water shortages are expected to be such a widespread problem in the future.
    12·1 answer
  • Fill in the blanks below with the correct word to complete the sentence.
    8·2 answers
  • What trait does cardiac and smooth muscles share?
    5·1 answer
  • Which plant can help remove pollutants in rivers and lakes?
    8·1 answer
  • An animal dies in mud, decomposes, and leaves an imprint, which is later filled by sediment to form a solid copy of
    7·1 answer
  • How does the process of meiosis affect the genetic information of an<br> offspring?
    5·1 answer
  • What do we call molecules that are only<br> made of hydrogen and carbon?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!