1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
shepuryov [24]
3 years ago
11

When does oxygen become part of the cellular respiration

Biology
1 answer:
Vinvika [58]3 years ago
8 0
Cells in the body combine glucose and Oxygen to make ATP and carbon Dioxide. So, that would be after Glycolysis. 
You might be interested in
1. Ano-anong mga Likas na Yaman ang sagana sa Asya​
Sedaia [141]

Answer:

what

Explanation:

6 0
3 years ago
Kangaroo rats are organisms found in the desert. Deserts have a hot, dry climate. Which three adaptations must kangaroo rats pos
Mnenie [13.5K]

Answer:

c

Explanation:

it  makes sense

3 1
3 years ago
Read 2 more answers
The test results below indicate the presence of which nutrient? four test tubes A. monosaccharide B. polysaccharide C. protein D
mel-nik [20]

Answer:

See below

Explanation:

Q1. incomplete information given

Q2. Protein will be present so <u>test tube C.</u> Beef is a rich source of protein. Hence, the Biuret test will be relevant in this case since that is specific to detecting proteins.

Q3. Orange juice has ample amount of simple sugars (such as fructose, glucose), which are monosaccharides. So option A. Benedict test is required here.

Q4. Incomplete information provided

Q5. You need a certain kind of food that is rich in protein and simultaneously lacks fats. Here, skimmed milk is relevant - fat has been removed from the milk although protein is still present.

7 0
4 years ago
What are the biological molecules
Svetradugi [14.3K]

Explanation:

Biomolecule, also called biological molecule, any of numerous substances that are produced by cells and living organisms. Biomolecules have a wide range of sizes and structures and perform a vast array of functions. The four major types of biomolecules are carbohydrates, lipids, nucleic acids, and proteins.

8 0
3 years ago
Not all dead organisms are acted on by decomposers. instead of being immediately recycled, the carbon from some organisms is kep
dsp73
The materials that contain this stored carbon are coal, oil, peat and natural gas.
The collective term for these four materials is Fossil fuel , decomposing fungi, bacteria, and worms. 
Many of the carbon based fuels are categorized as fossil fuels because they formed from the decayed organisms over millions of years. Fossil fuels are the buried combustible geologic deposits of organic materials, formed from decayed plants and animals that have been converted to crude oil, coal, natural gas, or heavy oils by exposure to heat and pressure in the earth's crust over hundreds of millions of years. 
6 0
3 years ago
Other questions:
  • Chloramphenicol did NOT inhibit translation in E. coli cells containing the cat6xbs expression plasmid. What experimental parame
    9·1 answer
  • Check all the ways listed below that ensure accurate reading of volume from a graduated pipette. tapping the base of the pipette
    15·2 answers
  • Replication is called semi-conservative because half of the original strands is
    9·2 answers
  • Ocean gyres can _________. Select all that apply. A. make hot climates cooler B. make hot climates warmer C. make cool climates
    8·2 answers
  • How would low-fat milk meet the body’s needs differently from whole milk?
    5·2 answers
  • You just performed 5 cycles and 2 minutes of CPR on an adult. You reassess for a pulse. No pulse is present. What is your next c
    9·1 answer
  • Platelets start a clotting reaction that intimately produces a clot composed of fibrin, is a form of what
    9·1 answer
  • 5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
    7·1 answer
  • What sex is the person who has the karyotype described in Steps 3-4? How do you know?
    5·2 answers
  • PLS HELP I’m not sure which one it is lol
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!