1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
8_murik_8 [283]
3 years ago
13

What happens when the top predator is removed from an ecosystem?

Biology
2 answers:
sasho [114]3 years ago
7 0
<span>C)The number of consumers decreases. </span>
Tema [17]3 years ago
6 0
The number of consumers increases
You might be interested in
In a population of plants, the allele for long stems is completely dominant over the allele for short stems. If 35% of the popul
KatRina [158]
Assumptions:
1. Equilibrium has been reached for the allele proportions
2. Absence of <span>evolutionary influences such as </span>mate choice<span>, </span>mutation<span>, </span>selection<span>, </span>genetic drift<span>, </span>gene flow<span> and </span>meiotic drive<span>.
</span>
Defining L=long stem, l=short stem, and L is dominant over l.
f(x) = frequency of allele x  (expressed as a fraction of population)
Then the Hardy-Weinberg equilibrium law applies:
p^2+2pq+q^2=1
where 
f(LL)=p^2
f(Ll)=2pq
f(ll)=q^2

Given f(ll)=0.35=q^2, we have
q=sqrt(0.35)=0.591608
p=1-q=0.408392
=>
f(Ll)
=2pq
=2*0.408392*0.591608=0.483216
= proportion of heterozygous population

Answer: percentage of heterozygous population is 48.32%
7 0
3 years ago
What are the two circuits of the cardiovascular system? What does it mean to say that the cardiovascular system is a closed syst
maksim [4K]

Answer:

The two circuits of the cardiovascular system are: Pulmonary Circuit and Systematic Circuit. The pulmonary circuit is shorter than the systemic and is responsible for carrying deoxygenated blood to the lungs from the right atrium, for oxygenation. The systemic circuit is longer and leaves the aortic artery, carrying oxygenated blood throughout the body and nutrients for survival. If less blood were pumped into the systemic circuit, this amount would not be sufficient to compensate for the organism's needs, with the corresponding consequences that this would entail.  

It is said that the cardiovascular system is a closed system because blood travels inside a network of blood vessels without leaving them.

5 0
3 years ago
There is no replication of DNA between meiosis I and meiosis II<br> True or false
Alexxx [7]

Answer:

False

Explanation:

They have been multiplied.

5 0
3 years ago
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Which of the following correctly describes where early Earth's water came from?
Lostsunrise [7]
B according to my school.
8 0
3 years ago
Other questions:
  • Coma and death can result when a loss of body water exceeds what percentage of total body weight?
    15·1 answer
  • Which of the following statements is true?
    7·1 answer
  • What do you think would happen to a jellyfish if it were placed in a freshwater lake?
    5·1 answer
  • Number 3 please and thanks
    11·1 answer
  • blueberries contain sugars like glucose. these sugars are produced by photosythesis. what is the source of carbon for the glucos
    8·1 answer
  • A scientist studies the DNA in corresponding genes of a platypus, a
    13·1 answer
  • Watch this video about a river that China is building. Explain how the river will help prevent the negative effects of drought.
    8·1 answer
  • Pls help and thank youuuu:)
    7·2 answers
  • Explain the term Asexual reproduction​
    14·1 answer
  • Substances change states when they move between solid, liquid, and gas forms. when a substance changes from one state of matter
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!