1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
egoroff_w [7]
3 years ago
14

A cross was made between a white male dog and two different black females. the first female gave birth to eight black pups, and

the second female gave birth to four white and three black pups. what are the likely genotypes of the male parent and the two female parents? explain whether you are uncertain about any of the genotypes.
Biology
1 answer:
Svetradugi [14.3K]3 years ago
4 0

In this case, the black body colour is the dominant one. The white dog is  homozygous recessive.

As the cross between the black female 2 and the white male results in all black pups. This means that the all the offsprings are heterozygotes and the Female 1 is homozygous recessive having a BB phenotype (where B codes for dominant allele).

As the cross between the black female and the white male results in four white and three black pups. This means that the all the black offsprings are heterozygotes, and the white ones are homozygous recessive and the Female 2 have a dominant and 1 recessive gene, and is a hetrozygotezygous recessive having a Bb phenotype (where B codes for dominant allele and b codes for recessive allele).

You might be interested in
From where do the gems used in jewelry come?
mr_godi [17]
I believe the answer would be C. pleas brainliest

8 0
3 years ago
Read 2 more answers
Is there really more than one gender? Most factually backed up answer gets brainliest.
EastWind [94]

yes, example : penis and vagina . #FACTS :)

3 0
3 years ago
Read 2 more answers
Qué son las bases nucleotídicas
shusha [124]

Answer:

Un nucleótido es el componente básico de los ácidos nucleicos. ... Un nucleótido consiste en una molécula de azúcar (ribosa en el ARN o desoxirribosa en el ADN) unida a un grupo fosfato y una base que contiene nitrógeno. Las bases utilizadas en el ADN son adenina (A), citosina (C), guanina (G) y timina (T).

Explanation:

8 0
3 years ago
Which condition causes fatty substances to build up in blood vessels?
serious [3.7K]
Atherosclerosis is a condition that occurs when fatty substances (plaque) build up in blood vessels. The accumulation of the fatty substances can cause partial or complete blockage of blood flow through an artery. Symptoms of this condition include a mini-stroke, pain in the chest <span>and pain in the leg muscles during exercise.</span>




3 0
3 years ago
Read 2 more answers
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
Other questions:
  • When glaciers melt, water is returned to groundwater storage by what means?
    10·2 answers
  • What statement is true regarding active transport
    6·1 answer
  • An inadequate secretion of thyroid hormones results in ___________, which is characterized by weight gain and lethargy, while an
    8·1 answer
  • Plants have chemicals that cause them to grow toward light by the process of---
    5·1 answer
  • A pathologic change in the cardiovascular system that involves degenerative changes in the arteries, promoting the accumulation
    11·1 answer
  • Need help with this
    8·2 answers
  • How does photosynthesis transforms light energy into stored chemical energy​
    13·1 answer
  • What are winds that blow in a certain direction most of the time and can produce surface currents called?
    11·1 answer
  • A jet flies 2000 meters/minute for 120 minutes. How far did it fly?
    9·1 answer
  • What relationships exists between frogs and fishes in a pod
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!