1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sattari [20]
3 years ago
12

What is the shape of DNA called

Biology
2 answers:
timurjin [86]3 years ago
8 0
B : double helix because a helix would be half of DNA / RNA and double helix is 2 helix
ivanzaharov [21]3 years ago
4 0
Double helix is the answer
Hope this helps!

You might be interested in
State what enzymes are made of
creativ13 [48]
Enzymes are large molecules that speed up the chemical reactions inside cells. Each type of enzyme does on specific job. Enzymes are a type of protein, and like all proteins<span>, they are made from long chains of different </span>amino acids<span>.</span>
4 0
3 years ago
Read 2 more answers
2.4 State two reasons why the fern plants are able to
crimeas [40]

Answer:

Explanation:

This is because ferns are vascular plants i.e they have vascular tissues which are xylem and phloems which help to conduct water and nutrients while mosses are non vascular plants.

2. Ferns sporophytes are differentiated into true leaves, stems and true roots while mosses lack true roots, stems and leaves.

Underground stems are modified part of plants that are derived from stem tissues which grow under the ground. Underground stems grow beneath the soil. Examples include Rhizomes, ginger, tubers e t.c.

5 0
3 years ago
Given the names of these three enzymes proteases, DNase, RNase what reaction do you expect each one to catalyze
kramer

Answer:

As the name suggests, proteases will be the enzymes which will catalyze the reactions of proteolysis. Proteolysis can be described as the process of breaking proteins into amino acids and simple peptide bonds.

DNases will catalyze the reactions for breaking down or degrading DNA. The DNase does this by breaking the phosphodiester bonds present in the backbone of the DNA.

RNases will be the enzymes which will catalyze the breaking of RNA molecules.

6 0
3 years ago
Which best describes what is happening in the area marked y
Zigmanuir [339]

Answer:

Oxygen is being released through the Stomata

Option (A)

4 0
3 years ago
Read 2 more answers
Explain why proteins are considered polymers but lipids are not
hammer [34]

Answer:

Polymers are made from a chain of one similar subunit bound together in sequence. Proteins are made from polypepetide chains which are sequences of amino acid subunits. Another example of polymer is DNA and RNA made of nucleic acid subunits.

However, lipids do not have one similar subunit but rather variable ways in which the lipid chains can form. For example phospholipid unit is made of a phosphate molecule bound to a fatty acid chain and glycerol. A triglyceride is a subunit of glycerol bound to three fatty acids chains. Cholesterol is also considered a lipid but is made of carbon rings rather than chains. Lipids therefore cannot be referred to as a polymer.

LearnMore:

To learn more on polymers check out;

brainly.com/question/6368957

brainly.com/question/12296309

brainly.com/question/9154529

#LearnWithBrainly

3 0
3 years ago
Other questions:
  • A protein has altered funtion as a result of a single amino acid substition in the polypeptide (protein). this change resulted f
    13·1 answer
  • Both frogs and ducks have webbed feet. However ducks are more closely related to perching birds than to frogs.
    15·1 answer
  • Intense competition would most likely occur between?
    9·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Zebras are classified as vertebrates because they have
    9·2 answers
  • Please help me i’m confused
    6·1 answer
  • Explain how a nymph grows or the molting process used for growing.
    14·1 answer
  • Explain how the melting of the sea ice may affect<br><br> people living on the coast of Florida.
    6·1 answer
  • A scientist studies the DNA in corresponding genes of a platypus, a
    13·1 answer
  • Which of the following conditions would lead to a snall population size?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!