1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
svetlana [45]
3 years ago
14

why do all organisms take in matter and rearrange atoms through chemical reactions to form molecules essential for life?

Biology
1 answer:
Tom [10]3 years ago
3 0
Cause living things can not directly use most of matter which they found in nature. For example carbon, all organism use carbon in complex structure, that is in compound or macromolecule(glucose,fructose,amino acid). we can not directly earn ATP from C which we found in soil/other sources.
You might be interested in
Which organelle is responsible for producing the energy for cellular processes?
Musya8 [376]
Organelle g the mitochondria
8 0
3 years ago
Read 2 more answers
The epidermis is the most superficial layer of the skin. It is composed of stratified squamous epithelium. Within the epidermis,
son4ous [18]

Answer:

a. Stratum corneum 5. : Thick superficial layer of flat, keratinized, dead cells; responsible for dandruff.

b. Stratum granulosum 3.: Cells flatten and fill with keratin, resulting in a grainy appearance.

c. Stratum lucidum 4. : Clear layer found only in thick skin; cells full of keratin.

d. Stratum basale 1. : Deepest layer; site of rapid cell division and melanin production.

e. Stratum spinosum 2.: Live keratinocytes connected by desmosomes produce pre-keratin

Explanation:

The epidermis has five layers, starting from the deepest one they are:

The stratum basale: is the layer that has the germinative cells, called keratinocytes.

The stratum spinosum: the keratinocytes are connected, and they produce the precursor of keratin and lipids.

The stratum granulosum: the name of this stratum is due to the appearance of the cells. They produce keratohyalin, and the lipids produced in the previous layer are released, creating the layer that protects the skin against dehydration.

The stratum lucidum: They are only in thick skin, like the one that is in the sole of our feet. The cells do not have a nucleus. They are filled with keratin, which is the component of thick skin.

The stratum corneum: the more superficial layer, it is made of dead cells filled with keratine. When new cells ascend to this stratum, the old ones have to be removed by exfoliation or natural peeling.

4 0
3 years ago
Which of the following do not match? <br><br>Prokaryotic and Anaerobic OR Eukaryotic and Anaerobic0​
Gnesinka [82]
Eukaryotic and Anaerobic
8 0
3 years ago
Which immunologic test could be used to determine the identity of the pathogen through the use of microscopy and fluorescently-t
alexandr402 [8]

Answer:

The answer is indirect immunofluorescence

Explanation:

Immunofluorescence is a technique used to detect antigens by colors in a scientific setting using antibodies.

The test that can be used to determine pathogens using microscopy and fluorescently tagged antibodies is "indirect immunofluorescence".

This is used to identify diseases that attack the autoimmune system.

I hope this answer helps.

6 0
3 years ago
4. (a) Primary production is the production of carbon compounds from carbon dioxide, generally by photosynthesis. Study
Stels [109]

The graph is showing how primary production decreases as deep increases. It is due to the amount of available light in the water.

<h3>Primary production on the ocean</h3>

The primary production in the ocean is performed by microorganisms known as phytoplankton.

Phytoplankton populations are primary producers that include bacteria and algae, which use photosynthesis to produce biomass and release oxygen.

In a similar manner to plants, phytoplankton communities also contain chlorophyll in order to convert sunlight into biomass.

As ocean deep increases, the amount of available light in the water decreases, thereby also decreasing the primary production of the phytoplankton populations.

Learn more about primary production here:

brainly.com/question/22283115

4 0
2 years ago
Other questions:
  • A mutation occurs in an eye cell of a full-grown monkey. What will most likely happen to the monkey?
    14·2 answers
  • Which of the following is true of fertilization in conifer? Please don't copy and paste I needed actual help from someone who kn
    12·2 answers
  • I dont really now so can u help me ​
    8·2 answers
  • Please help!! What are the different types of interactions in nature?
    14·2 answers
  • Describe the makeup of volvox
    9·1 answer
  • Twenty-five people developed symptoms of nausea, vomiting, and diarrhea three to six hours after attending a church picnic where
    9·1 answer
  • Bedding is a form of asexual reproduction that results from the outgrowth of a part of a cell or body region leading to a separa
    7·2 answers
  • Which of the following kingdoms contains prokaryotes? a. protista b. eubacteria c. plantae d. fungi
    15·2 answers
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • What was Robert Hooke's contribution to cells?
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!