1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
katrin [286]
3 years ago
15

Which of the following is the healthiest type of carbohydrate

Biology
1 answer:
Free_Kalibri [48]3 years ago
4 0

Answer:

bofa these nutz

Explanation:

You might be interested in
An organism that reproduces sexually has a diploid number of 50 how many chromosomes will a gamete of this organism have
nataly862011 [7]
A gamete of this organism will have half that number (50), the haploid number of 25 chromosomes.
6 0
3 years ago
Read 2 more answers
Which is released during the formation of a peptide bond
hammer [34]
A molecule of H2o or Water
7 0
3 years ago
Read 2 more answers
If a single strand of a gene contains 726 bases, 242 amino acids will make up the polypeptide prepared from it, assuming every b
Mazyrski [523]

The answer is true. During translation of mRNA, the nucleotides are read by the translation unit (ribosome and trna) in sequences of three (3). These sequences are referred to as codons. Codons code for amino acids. Some codons are start of stop codons meaning they initiate or terminate translation. Additionally, more that one codon could code for one amino acid.  






6 0
3 years ago
States that only living organisms can produce other living organisms
andrew-mc [135]

Answer:

Biogenesis

Explanation:

The theory of biogenesis states that only living organisms can produce other living organisms.

7 0
3 years ago
I need help with biology please
IgorC [24]

Answer:

All but B are true

5 0
3 years ago
Other questions:
  • Chlorophyll b absorbs in green wavelengths of light that chlorophyll a cannot absorb. in this respect, chlorophyll b acts as
    10·1 answer
  • Which factor was most responsible for the production of oxygen by the elodea? a the presence of light stimulated photosynthesis.
    6·1 answer
  • Coral reefs are unaffected by pollution.<br> true or false
    13·1 answer
  • Describe at least one societal issue that scientists will be able to address using the sequence of the human genome.
    11·1 answer
  • I need help guys on this question
    8·2 answers
  • Question What characteristics are used to classify organisms?
    6·2 answers
  • Where is freshwater found? Select 3 options.
    8·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • Please help I’ll mark you as brainliest if correct
    9·1 answer
  • A fire totally destroyed a forest. It will gradually undergo “succession.” What does this mean?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!