The building blocks are amino acids
True because Weathering is the process breakdown of materials through physical or chemical actions and Erosion occurs when weathered materials such as soil and rock fragments are carried away by wind, water or ice. Many forces are involved in weathering and erosion, including both natural and man-made causes.This will causes rocks to disintergrate
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
Answer:
The answer choices to this question are:
A) She releases cement particles into a random number of the coral samples.
B) She uses three different types of coral to establish her dependent variables.
C) She treats the coral samples identically with varying levels of carbonic acid.
D) She obtains her coral samples from coral reefs surrounding different continents.
Best Answer is:
A) She releases cement particles into a random number of the coral samples.
Theory:
It has been researched that ocean acidification caused by carbon dioxide emissions causes a decrement in the coral reef growth and this will keep slowing down unless steep and rapid reductions in greenhouse gas emissions are made. And the Coral reefs offered economic opportunities would advantage the surrounding communities from fishing and tourism.
i did this question so thats why i know the answer choices
hope this helpsss
Answer:
70 million people are added
Explanation:
