1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
BaLLatris [955]
3 years ago
8

Why might a baby be born early if the mother smokes?

Biology
1 answer:
TiliK225 [7]3 years ago
7 0

Answer:

Smoking during pregnancy has a number of problems for the mother and the baby. Often, smoking during pregnancy leads to miscarriage or premature birth of the baby. The weight of the baby is also lower as compared to the babies whose mothers do not smoke during pregnancy. As the conditions inside the mother are not safe of the mother smokes, hence babies are often born early for such mothers. The placental might detach early from the uterine tube.  

You might be interested in
An object with a kinetic energy of 200 J and Potential energy of 300 J, has a mechanical energy of what?
True [87]

Answer:

500 J

Explanation:

Emechanical=U+K,i.e., the mechanical energy Emechanical is the sum of the potential energy U and kinetic energy K.

So, the object has a mechanical energy of 200+300=500 J.

4 0
3 years ago
With respect to the lobes of the brain, the frontal lobe is involved in ________ and the occipital lobe is the final destination
Simora [160]
The answers are motor control; visual information
5 0
2 years ago
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
2 years ago
"Which term correctly identifies the process by which molecules move through the dialysis tube membrane?
SSSSS [86.1K]
I think the correct answer from the choices listed above is option 3. The term that correctly identifies the process by which molecules move through the dialysis tube membrane would be diffusion. <span>The molecules move from a region where they are in high concentration to a region where they are in low concentration.</span>
5 0
2 years ago
What is the process of meiosis 2
Cloud [144]

Answer:

During meiosis II, the sister chromatids within the two daughter cells separate, forming four new haploid gametes. The mechanics of meiosis II is similar to mitosis, except that each dividing cell has only one set of homologous chromosomes.

Explanation:

7 0
3 years ago
Other questions:
  • 1. A source of simple carbohydrates is<br> a. seeds c. fruits<br> b. brownrice d. potatoes
    5·2 answers
  • When DNA replication occurs before meiosis, the original DNA strand CAG TGT TTA TAG is copied into complementary strand GTC ACA
    6·2 answers
  • Cells make up all living things. they can be seen only if they are
    15·2 answers
  • Proteins scan chromosomes for damage during the G1 checkpoint. beginning of the synthesis phase. apoptosis phase. G2 checkpoint.
    13·1 answer
  • Near and far vision are accommodated through the muscles of the
    13·2 answers
  • Which of the following statements supports why sexual reproduction might give organisms the chance to survive a worldwide pandem
    14·1 answer
  • Describe two traits that represent a sustainable society and two traits of a unsustainable society
    10·2 answers
  • How many protons are there in the nucleus of an atom with an atomic number of 15
    14·1 answer
  • What is the main benefit of this model?
    6·1 answer
  • Compare and contrast mutualism, commensalism, and parasitism.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!