1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mrrafil [7]
3 years ago
6

5. What two systems are primarily involved in processing food? *

Biology
1 answer:
quester [9]3 years ago
6 0

B and D

hoped i helped

You might be interested in
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
A machine called os used for both harvesting and threshing<br>​
Bess [88]

Answer:

<h2><u>combine harvester</u></h2>

Explanation:

hope this helps you!!

4 0
2 years ago
Read 2 more answers
Zirconium has an atomic number of 40 and an atomic mass of 91. How many neutrons does it have?
Natali [406]
Subtract the atomic number from the atomic mass to get the neutrons 
7 0
3 years ago
9. Which density-dependent factors other than the predator/prey relationship affected the
Akimi4 [234]
D: food availability for the moose and disease for the wolf
3 0
3 years ago
________ are cells that make up the brain and spinal cord and transmit electrical signals from receptor to effectors.
Dafna11 [192]
I think the answer here is neurons, the nerve cells
3 0
2 years ago
Other questions:
  • Euglena use __________ to move through their environment and to help collect food. A) cilia B) flagella C) pseudopods D) vacuole
    10·1 answer
  • An ecosystem consists of a
    10·2 answers
  • Which process is responsible for the growth and repair of human tissue
    7·1 answer
  • How do fish obtain oxygen?
    13·1 answer
  • You are monitoring the results of laboratory tests performed on a client admitted to the cardiac icu with a diagnosis of myocard
    11·1 answer
  • The patient is recovering from hypovolemic shock. The nurse hangs a bag of normal human serum albumin (Albutein) and educates th
    8·1 answer
  • In general, how do many human activities influence the carbon cycle?
    11·1 answer
  • A rock changed by heat pressure, and fluids
    10·2 answers
  • What are the precautions that should be token when using a photometer? please help me​
    5·1 answer
  • Two pea plants are crossed. Each is heterozygous for height (T = tall, t = dwarf) and purple flowers (P =
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!