1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Helga [31]
3 years ago
7

What organelle is the site of cellular respiration?

Biology
1 answer:
Mamont248 [21]3 years ago
6 0
Mitochondria is the organelle
You might be interested in
HELPPPPPP ASAPPPPPPPP HELPPPP
Andrei [34K]
Little to no agitation I’m pretty sure
3 0
3 years ago
Read 2 more answers
How does factory farming impact workers, specifically undocumented people and people of color?
vivado [14]

Answer:

Driven by rigid contracts set forth by their corporate partners, factory farms knowingly jeopardize workers' health in order to maximize profits. A large percentage of factory farm workers are black and brown peoples including migrant workers from Mexico and other parts of Latin America.

Explanation:

8 0
3 years ago
Skin has epithelial cells that resist stretching and twisting because they are held together by what
KatRina [158]

The epithelial cells resist stretching and twisting in the skin because if desmosomes that holds them together. The desmosomes are the one responsible for the cell to cell adhesions, making them be tight or held together as this is its structure.

7 0
3 years ago
A meter contains __________ centimeters
bearhunter [10]
100 centimeters make up one meter
7 0
3 years ago
Read 2 more answers
39 Assume the ilghe wave directed at the paper is white light and the paper contains pigments that absorb the wavelerigens of
finlep [7]

Answer:

Black  

Explanation:

The paper absorbs light of all visible wavelengths.

No visible light is reflected.

The paper will appear black to human eyes.

3 0
3 years ago
Other questions:
  • What comes After the zygote develops into a larger organism?
    13·2 answers
  • If our visual perception depends only on the feature detectors in the visual cortex, what would we see?
    8·1 answer
  • Heat is a product of<br> a. respiration<br> b. photosynthesis<br> c. osmosis<br> d. diffusion
    12·1 answer
  • Where is the oldest layer of sediment? the bottom, top or middle ?
    10·2 answers
  • Why are autotrophs considered the basis of the food chain?
    11·1 answer
  • Cellular metabolism extracts and releases energy in an organized manner. True False
    15·1 answer
  • As a group living things must be able to do all of the following except
    12·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • It is not always possible to measure every individual in a population; what is the name of the representative group?
    8·1 answer
  • What is an argument in favor of using embryonic stem cells over adult stem cells?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!