1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ELEN [110]
3 years ago
11

PLZ HELPPPPP During one interval of the game of fetch, a dog ran 27 meters in 9 seconds.

Biology
2 answers:
aliya0001 [1]3 years ago
8 0

Answer:

Answer:

B. 3.0 m/s.

Step-by-step explanation:

Average speed = distance / time

=  180 / 60

= 3.0  m/s.

Explanation:

gulaghasi [49]3 years ago
5 0

Answer:

bfvbg

Explanation:

You might be interested in
Why is gwas used for complex disease studies?
kramer
A GWAS can be performed by actually genotyping as few as 300000 to 1million
4 0
3 years ago
Develop 3 questions about how genetic disorders are passed from one generation to the next, using the terms: DNA, chromosomes, a
Delicious77 [7]
Can certain diseases be hereditary?
Are genetic disorders passed though DNA?
Can we predict certain diseases based on certain chromosomes?
5 0
3 years ago
Describe how the experiments of Avery, McCarty and MacLeod, building on the work of Griffith demonstrated that DNA was the molec
cluponka [151]
<span>It was the culmination of research in the 1930s and early 1940s at the Rockefeller Institute for Medical Research to purify and characterize the "transforming principle" responsible for the transformation phenomenon first described in Griffith's experiment of 1928: killed Streptococcus pneumoniae of the virulent strain type III-S, when injected along with living but non-virulent type II-R pneumococci, resulted in a deadly infection of type III-S pneumococci.</span>
7 0
4 years ago
 Joletta thinks she knows how to cure cancer. A family member of hers had cancer, but he did not die. Joletta noticed that he at
ASHA 777 [7]
Definitely C) she did not have enough information to prove her theory to be right.
6 0
3 years ago
Read 2 more answers
In regions of the cardiovascular system where there is steady laminar blood flow, the shear stress on cells lining the walls of
Lynna [10]

Answer:

250 N/m2

Explanation:

Shear stress on cells lining the walls of the blood vessels  is equal to 2020 dyne/cm2

In terms of Newton/square meter, shear stress is equal to

20*\frac{dyne}{cm^2}  (\frac{10^{-5}N}{1 dyne} )*(\frac{1 cm^2}{10^{-4}*m^2} )\\= 2.0 N/m2

Shear modulus is equal to shear stress divided by shear strain

Thus, shear modulus is equal to

= \frac{2.0}{0.008} \\= 250N/m2

7 0
3 years ago
Other questions:
  • Which of the following statements is true about biomes?
    11·1 answer
  • What area would be most affected if north atlantic disappeared
    14·1 answer
  • What causes over growth in humans
    11·2 answers
  • A geneticist discovers a new mutation in Drosophila melanogaster that causes the flies to shake and quiver. She calls this mutat
    9·1 answer
  • A person with prediabetes has a fasting blood glucose level of _____.
    11·1 answer
  • Which of the following describes the process of deflation.
    7·2 answers
  • what happened during the industrial revolution that led human activity to contribute to climate change?
    8·2 answers
  • Which statement is not an example of intercellular communication? A message travels between gap junctions. An electrical signal
    6·2 answers
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Two Bio 45 students are having a disagreement about renal function. Dan says that the kidneys work harder when you eat a high-sa
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!