1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
miss Akunina [59]
3 years ago
13

3. 150 marlin were captured, tagged, and returned to the deep ocean, where they live,

Biology
1 answer:
san4es73 [151]3 years ago
8 0
283 marlins; 89% increase (i rounded but raw percentage would be 88.6%)
You might be interested in
Why does the oxygen atom in a water molicule have a negative charge
scZoUnD [109]

Answer:

In the covalent bond between oxygen and hydrogen, the oxygen atom attracts electrons a bit more strongly than the hydrogen atoms. The unequal sharing of electrons gives the water molecule a slight negative charge near its oxygen atom and a slight positive charge near its hydrogen atoms.

Hope it helps!

3 0
2 years ago
Read 2 more answers
What is the pH of the human body, and is it acidic, basic or neutral?
Dmitriy789 [7]
Blood is slightly basic with a pH of about 7.35 to about 7.45.

Hope this helps! Please make me the brainliest, it’s not necessary but appreciated, I put a lot of effort and research into my answers. Have a good day, stay safe and stay healthy.
3 0
2 years ago
Which respiratory function describes the exchange of oxygen and carbon dioxide in the cells?.
9966 [12]

Answer:Cellular Respiration

Explanation:

Cellular respiration is the process by which cells produce energy, and is broken down into three more steps: glycolysis, Kreb’s cycle, and electron transport chain. Glycolysis requires glucose, two ATP, and NAD+, and two ADP, and produces two pyruvate, four ATPs, two NADH, and two H2O. The Kreb’s Chcle and thus the downstream electron transport chain require acetyl-CoA, one ADP, three NAD+, and one FAD, but pyruvate oxidation needs to happen prior to the Kreb’s Cycle, thus this is where the Oxygen is used and produced into two CO2.

5 0
1 year ago
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
Why is a species with a small population more likely than a large population to undergo an extinction?
Dima020 [189]
Small population usually cant find a mate or be able to continue a species. 
8 0
3 years ago
Other questions:
  • Which of the following represents a parasitic relationship? tick on a dog lion eating a zebra bees pollinating flowers two frogs
    6·2 answers
  • 1)Most of the food we eat can be influenced by whom?<br><br> 2)Food choices come from what?
    11·1 answer
  • What would the oxygen measurements be on either side of the apparatus if there were no fish in it and the two chambers were full
    15·1 answer
  • Hot spots can also be found along plate boundaries? True or false.​
    6·1 answer
  • In multicellular organisms, the process of cell division leads to in the cell number
    12·2 answers
  • The stretch hold is a restraint technique:
    9·1 answer
  • What are fossils? <br> Please help.
    9·2 answers
  • Most binary ionic compounds are also called metals.<br> A. True<br> B. False
    12·1 answer
  • What would happen with the carbon cycle if there were no biosphere?
    5·2 answers
  • What is/are the function(s) of the cell cycle? dna replication development of positive mutations prevention of cancer growth, re
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!