1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aleksklad [387]
4 years ago
15

In the parts of the investigation that follow, we conduct experiments using leaf disk samples to test whether they are undergoin

g photosynthesis based on whether they float in solution. What gives the leaf disks their buoyancy?
Biology
1 answer:
Ronch [10]4 years ago
3 0
<h2>Leaf discs        </h2>

Explanation:

Leaf disks float normally,when the air spaces are replaced with water the overall density of the  leaf disk increases and the disk sinks

The saturating solution should include a small amount of  sodium bicarbonate

Bicarbonate ion serves as the carbon source for photosynthesis

As photosynthesis proceeds, oxygen accumulates in the air spaces of the spongy mesophyll, the leaf becomes buoyant and floats

While this is going on, the leaf is also carrying out cellular respiration; this respiration will consume the oxygen that has accumulated and possibly cause the plant disks to sink

The rate that the disks rise is an indirect measurement of the net rate of  photosynthesis

You might be interested in
OMARK FOR REVIEW
Radda [10]

Answer:

Botulism

Explanation:

6 0
3 years ago
Match the situation to the correct transport described.
san4es73 [151]
1. C
2. E
3. A 
4. B
5. D
7 0
3 years ago
Which letter indicates the cavity that contains the digestive organs?
prohojiy [21]
It is the abdominal cavity that contains the digestive organs.
8 0
4 years ago
Which option uses the monitoring method to check the growth of invasive species?
KonstantinChe [14]

Answer:

The answer is A.

4 0
3 years ago
Read 2 more answers
What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT
Eddi Din [679]

Thymine(T) pairs with adenine(A)

Adenine(A) pairs with uracil(U)

Cytosine(C) pairs with guanine(G)

therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT

is

AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA

4 0
3 years ago
Other questions:
  • ________ are extrachromosomal dna molecules that are not part of the bacterial genome.
    9·2 answers
  • How is the work of a volcanologist similar to the work of a life scientist? How do the two jobs differ?
    7·1 answer
  • Hey!! Could someone help me? I need a definition and examples of geology!!
    7·1 answer
  • How much does an elephant weight
    15·2 answers
  • Plants and __________ formed a mutualistic relationship in the form of mycorrhizae and were the first multicellular organisms on
    15·1 answer
  • How can humans influence traits in dogs or other organisms?
    13·1 answer
  • How are you part of the carbon cycle? How do you obtain carbon from the enviroment? How do you return carbon to the environment?
    9·1 answer
  • What is the name for the underground layer of permeable rock that contains water
    9·2 answers
  • Water makes up a large percentage of the body's cells. For a cell to remain in homeostasis, there must be a
    8·2 answers
  • Write a pragraph summarizing the main functions of the digestive system. Will give branliest.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!