1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tatiyna
3 years ago
7

Which of the following is not used by plants for photosynthesis?

Biology
2 answers:
lys-0071 [83]3 years ago
8 0

Answer: oxygen

Explanation:

The photosynthesis equation is:

water+carbon dioxide + sunlight—> glucose + oxygen

Oxygen is a product of photosynthesis, not used in the process.

Carbon dioxide and water are both used in the process, and chlorophyll traps light energy from the sun.

Hope this helped!

Anastaziya [24]3 years ago
6 0

Answer:

C. oxygen

Explanation:

Oxygen is the product of photosynthesis. Photosynthesis is a process in which glucose and oxygen are produced by the combination of carbondioxide gas and water in the presence of sunlight. Glucose is stored in different parts of plant body and oxygen is released in the atmosphere which is used by living organisms. Carbondioxide is taken by the plants from the atmosphere through stomata and water is absorbed by the plant from the soil through roots.

You might be interested in
A bar graph would best represent________variation
ArbitrLikvidat [17]

Answer: A. because it makes the most sense also what behavor and it depends on that as weel and envrionmental you graph a lot of stuff

Explanation:

5 0
2 years ago
What is the overall charge on the cytoplasmic side of a plant cell plasma membrane? A. positive B. negative C. neutral
Artist 52 [7]

The correct option is B: Negative

The overall charge on the cytoplasmic side of a plant cell plasma membrane is <u>negative.</u>

A plasma membrane is a kind of membrane that separates the inner material of the cell from the outer side material and is also called a cell membrane.

Only in plants and bacteria, a cell wall is present on the outer side of the cell membrane whereas in animals the cell wall is absent.

It also protects the cell material from the outer materials that are harmful in nature.

When an impulse occurs the overall charge on the cytoplasm of the membrane becomes negative.

If you need to learn more about plasma membranes click here:

brainly.com/question/1873225

#SPJ4

7 0
2 years ago
Insulin is released by the beta islets of the pancreas after a meal when glucose levels are high. Released as a peptide, insulin
erastova [34]

Answer:

The correct answers are the second and the last statement.

Explanation:

Insulin refers to a hormone produced in the body that assists in monitoring the procedure of delivering glucose and storing it. The discharging of insulin takes place by the beta islets found in the pancreas. The discharging of insulin takes place when the level of glucose in the bloodstream increases. At that time, insulin assists in uptaking glucose for its metabolism and also in its storing.  

The insulin exhibits a transmembrane receptor that comprises a tyrosine kinases intracellular domain. The insulin combines with its receptor at its external edge and results in a variation in its conformation, which stimulates two tyrosine kinases. The tyrosine kinase refers to a dynamic part of the receptor that moves around.  

The stimulation takes place because of the phosphorylation of the tyrosine kinases that then phosphorylates other proteins like intracellular signaling partners. This stimulation of tyrosine makes a path for the combination of ATP with the active site.  

6 0
3 years ago
A proteins what can be described as the local folding of a polypeptide
Bad White [126]

Here da answer UWU

The next level of protein structure, secondary structure, refers to local folded structures that form within a polypeptide due to interactions between atoms of the backbone

8 0
3 years ago
What is physical science​
kozerog [31]

Explanation:

the science concerned with the study of inanimate objects including physics,chemistry and related subjects

6 0
3 years ago
Read 2 more answers
Other questions:
  • Help please and thank you
    5·1 answer
  • I need help w these
    8·1 answer
  • Which of these changes is a benefit of using only nonpolluting sources of electricity?
    5·1 answer
  • What is the endocrine system responsible for in the body
    6·2 answers
  • True or false? The lungs have an efficient blood supply to take away the oxygenated blood and maintain the concentration gradien
    11·1 answer
  • Why is a squid considered a cephalopod?
    8·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • How many density difference in the rock at a mind-ocean ridge help to drive plate motion?
    6·1 answer
  • Hi!!! so I need someone to answer the 7 questions on this "Sci-Lit" quiz its for a biology class. (I WILL MARK BRAINLIEST IF COR
    5·1 answer
  • Compare and contrast the oxygen cycle and the nitrogen cycle.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!