1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
beks73 [17]
4 years ago
12

Which does erosion do?

Biology
2 answers:
N76 [4]4 years ago
8 0
4) moves bits of rock and soil
Stella [2.4K]4 years ago
8 0
Option 4 is your answer, moves bits of rock and soil
You might be interested in
Helppppp meeeeee plsssss
sp2606 [1]

Answer:

Solar eclipse

Explanation:

Solar  eclipse happens when the moon is covering up the sun. As the picture is showing, the moon is covering up the sun and casting a shadow onto the earth.

8 0
3 years ago
What happens during the S phase of the cell cycle?
Ulleksa [173]

Answer:

C. The cell copies its organelles.

6 0
4 years ago
1. What might happen to an organism whose DNA is damaged through mutation?
Evgen [1.6K]

1.well mutations can cause cancers and alot of diseases however in some cases mutations can be good. for example people in Africa are not affected by malaria

2. the deletion or addition basically change of order in the genetic code. for example A goes with T. DNA can be damaged if A is paired with C

4 0
3 years ago
How is mitosis different from mitosis ​
Anon25 [30]

Answer:

Mitosis produces two diploid (2n) somatic cells that are genetically identical to each other and the original parent cell, whereas meiosis produces four haploid (n) gametes that are genetically unique from each other and the original parent (germ) cell.

8 0
3 years ago
16. Which choice best describes methane (CH4)2
const2013 [10]

Answer:B

Explanation:

because amino acid is the only best choice to describe methane.

5 0
3 years ago
Read 2 more answers
Other questions:
  • A 58 year-old man with an enlarging right hydrocele is here for surgical repair. he is taken to the operating room where the hyd
    12·1 answer
  • What might a scientist do to determine evolutionary relationships among groups of organisms? (select all that apply.) use plasmi
    6·1 answer
  • Restriction enzymes are collected from what
    12·1 answer
  • 3.a group of tissues that work together to perform a similar function. A.cell B.organelle C. molecule D.organ
    14·2 answers
  • HELPPPPP! What role does the esophagus play in the human body and what is its importance in the human body
    11·2 answers
  • AUUUAACUGUUCUGUCUAGAG
    6·1 answer
  • What is a ecosystem? write 2 to 5 sentences to explain it​
    8·1 answer
  • Aristo was riding in a car and noticed a pond that was covered in algal blooms due to excess phosphorus in the water. Which of t
    5·2 answers
  • Look at the diagram.
    10·1 answer
  • Describe the steps in Krebs cycle that produce reduced coenzyme.(6marks)​
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!