1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
umka21 [38]
3 years ago
13

What is the mass of 2.65 millimoles of sulfur?

Chemistry
1 answer:
Bas_tet [7]3 years ago
6 0
Divide this problem in to two steps: 1. Convert millimoles to moles. 2. Convert moles to grams.

1.
2.65 mlmol x 1mol/1000mlmol=.00265mol

2.
.00265mol x 32.065g/1 mol=.0850g S

Let me know if you need more explanation on why I used the conversions that I did.
You might be interested in
You are playing a game “will it float?” In this game, you are given a large, square can of tuna. If you know the density of wate
saul85 [17]

Answer:

I think it's just density of the tuna

5 0
3 years ago
PLZ HELP, BRAINLIEST TO WHOEVER GIVES WORK TOO!!​
Flura [38]

Answer:

1.15 hours

Explanation:

If they are going 100 kilometers an hour, and they need to go 115 k, then do 115/100 which is 1.15 which is the time

5 0
3 years ago
Who is Gregor Mendeſ, and what did he<br> discover about traits?
shtirl [24]

Answer:

Gregor Mendel, through his work on pea plants, discovered the fundamental laws of inheritance. He deduced that genes come in pairs and are inherited as distinct units, one from each parent. Mendel tracked the segregation of parental genes and their appearance in the offspring as dominant or recessive traits.

Through his careful breeding of garden peas, Gregor Mendel discovered the basic principles of heredity and laid the mathematical foundation of the science of genetics.

Explanation:

8 0
3 years ago
Why might changes to an environment cause an organism’s population to decrease?
givi [52]
Pollution and people littering. Can change everything.
6 0
2 years ago
If molar mass of M(OH)3 = 78 8. mass of M​
Cerrena [4.2K]

Answer:

From molar mass=total RAM of each individual element

78.8=(16+1)×3+M

78.8-51=M

27.8g/mol=M

5 0
3 years ago
Other questions:
  • Entropy is greater at higher trophic levels than at lower levels.. True of False
    11·2 answers
  • What is the mass of a steel cylinder that has a density of 75.0 g/mL and a volume of 12 mL?
    12·2 answers
  • What is the complementary DNA strand for the following sequence:<br> ATGGCTTGCCAAGGTCCGGAAACTTTG
    7·1 answer
  • Read the false statement. Atoms of elements with one valence electron form anions in order to meet the octet rule. Which answer
    9·2 answers
  • Flammability is a material’s ability to burn in the presence of
    6·1 answer
  • Which structure is found in plant cell but not in an animal cell ?
    10·1 answer
  • Can someone help me please. This is the last day
    10·2 answers
  • Runoff from agricultural land carries chemicals from fertilizers that collect in a lake. The buildup of chemicals can eventually
    11·1 answer
  • ____________ use cleaning solutions that eventually become spent and must be disposed of properly.
    7·1 answer
  • Write a balanced equation for the reaction of Zn(H₂O)₄²⁺ in aqueous NaCN.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!