1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
defon
2 years ago
6

The picture shows us how the Sun's rays strike Earth. Because of the Earth's tilt on its axis, some parts of Earth are having su

mmer and others, winter. What letter or letters on the Earth are experiencing summer?

Biology
2 answers:
kari74 [83]2 years ago
6 0

Answer:

c and d

Explanation:

Oksana_A [137]2 years ago
5 0

Answer:

C

Explanation:

the suns rays are closest to C

--<em>Brainliest answer is much appreciated! :)</em>

You might be interested in
Detail the relationship between diploid cells and homologous chromosomes
Artemon [7]

Answer:

A diploid cell is a cell that contains two complete sets of chromosomes. This is double the haploid chromosome number. Each pair of chromosomes in a diploid cell is considered to be a homologous chromosome set. A homologous chromosome pair consists of one chromosome donated from the mother and one from the father.

Explanation:

4 0
3 years ago
Can any one help pls if u can’t see it pls zoom the picture ty
GuDViN [60]

Answer:

its letter c

Explanation:

correct me if im wrong

6 0
2 years ago
Read 2 more answers
Discuss the impacts of biotechnology on individuals, society, and the environment
timofeeve [1]
It affects the environment by maybe causing pollution
5 0
3 years ago
Read 2 more answers
How do you show the presence of a trait in a pedigree?
zubka84 [21]
To show he presence of a trait you would need to follow it through multiple generations in a pedigree.
6 0
3 years ago
The Greek scientist Galen theorized that:
dimulka [17.4K]

Answer:

A. Food was turned into blood, and when it reached the heart it was mixed with air to make 'spirit.'

Explanation:

Galen believed a theory of pneuma. That is, he believed that blood contains "vital spirits" released into it by the brain.

6 0
1 year ago
Read 2 more answers
Other questions:
  • what molecules will be best used to compare different species with the exact same sequence of amino acids? why would two species
    9·1 answer
  • Potent refers to:
    10·1 answer
  • in a small oak tree the biomass of insects makes up about 3000 kilograms. this is 4% of the total biomass of the tree. What is t
    9·2 answers
  • What is used to transport proteins in a cell
    15·2 answers
  • Which organism would receive the least amount of tramsferred solar energy Owl,field mice frog,or grass
    15·1 answer
  • The four stages of cellular respiration do not function independently. Instead, they function ______
    8·1 answer
  • With which of the following statements would a biologist be most inclined to agree?
    10·1 answer
  • GIVING BRAINLIEST:)
    13·2 answers
  • Which is the correct answer
    12·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!