1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jeka57 [31]
3 years ago
9

Small molecules of dna exist in bacteria as circular units. they contain few genes but are extremely important since they carry

traits for drug resistance. these molecules are known as
a. chromosomes.
b. nucleoids.
c. plasmids.
d. nucleoli.
e. lysosomes
Biology
1 answer:
Sergeu [11.5K]3 years ago
6 0
These circular DNA molecules are called C: Plasmids
You might be interested in
The United States uses units such as inch, mile, ounce, and pound. Most of the rest
Murljashka [212]

Answer: Metric System

Explanation: The metric system is a more logical way of explaining measurements because it uses base ten to go up or down in the scale of measurement. This makes it more efficient and reasonable, on top of being easier to learn.

8 0
2 years ago
If the room you are in became low in oxygen, why would you suffocate?
skad [1K]

Answer: B

Explanation:

carbon monoxide is poison and can kill you

4 0
3 years ago
Which of the following statements describes an example of natural selection?
nignag [31]
An aloe vera plant possessing a trait for extra thick leaves survives very long droughts in deserts, while and aloe vera plant that doesn't have thick leaves doesn't.
7 0
4 years ago
Read 2 more answers
What percentage of nitrogen does our atmosphere contain?
alekssr [168]
Earth's atmosphere is 78%<span> nitrogen </span>21%<span> oxygen, </span>0.9%<span> argon, and </span>0.03%<span> carbon dioxide with very small percentages of other elements.
hope it helps</span>
5 0
3 years ago
Which of the following elements has the highest atomic mass?
Lady bird [3.3K]
I think its A but I'm not sure. 
3 0
3 years ago
Read 2 more answers
Other questions:
  • The Clean Water Act does not ensure high water quality throughout the nation because it does not _____.
    14·2 answers
  • What are ionic bonds formed by?​
    11·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Describe what occurs as epidermal cells move away from the dermis.
    10·1 answer
  • How is ADP converted to ATP?
    8·1 answer
  • How does one species become two different species? 3 sentences.
    10·1 answer
  • Bronchi are two narrow tubes that lead into the lungs.<br> O True<br> O False<br> 
    13·1 answer
  • An amino acid molecule includes a central carbon atom bonded to _____, a carboxyl group, and a hydrogen atom.
    6·1 answer
  • The plant cell below has some damaged organelles. What would MOST LIKELY result from this damage to the cell?
    9·1 answer
  • What is the correct order of the stages of Mitosis?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!